Infection of HCV is main cause of acute and chronic hepatitis, and is tightly related to liver fibrosis and hepatic cell cancer. There are more than 170000000 people who are HCV patients in the world, 85% of who are developing to chronic hepatic diseases, but at therapy aspect, there are absent of ideal anti-virus drugs.At present, Therapeatuic responding rate with polyethylene glycol (PEG) IFN and ribavirin may be improved to 70%, but in China, Gene type-I type which is common respond the drug worse, and cost of IFN is more expensive and side effect is more, following PEG, whose side effect is more distinctive. So, researchers are also actively exploring gene therapy of anti HCV virus in order to acquire more effective and saiver therapeatuic tool.During of HCV gene therapy, we used technique of antisense oligonucleotides,ribozyme and deoxyribozyme, but, there are more questions to resolve. RNA interfering (RNAi), also called RNA interference, which has a character of interventional related genes special degradation, so which becomes a new gene therapeutic usage of directing to virus,tumor and related diseases. It is the special gene silent discipline which through double Stranded RNA intervention, agter transcription, mRNA level shut responding gene expression, and it is a defensive discipline of gene group in vivo defensing outside infection and inside transposition, which extensive lying kinds of organism, for example: plant,fugi,insects,metazoans,mammals, and including people. Recent years′studying indicated: the same source double stranded RNA (ds RNA) in transcription mRNA in target gene transcribed in to cells. Which can efficiently and specially degrade the mRNA, so, inhibite related gene expression, resulted to responding function phenotype′s loss, leaded to no mutation of similar target site expression, which process belonged to after transcription gene silent discipline.HCV is a single-stranded plus sense RNA virus with envelope, belonging to yellow virus family, whose gene group′s whole length is 9379-9481nt, by sequence, 5′no coding region (5′-UTR), core protein region (C), enveloping region (El-E2), P7 protein region (P7), no structure region (NS2, NS3, NS4, NS5), 3′no coding region (3′-UTR), including a open reading frame (ORF). Inside, single polypro precursor of coded 3010-3033aa, it splits into structure protein, el, e2, p7, and not structure protein (NS2, NS3, NS4, NS5) trough host signal peptide and virus protease NS5 lies in 6258-9374nt of gene group, which splits into NS5A and NS5B through NS3 serine protease. The function of NS5A had already to identify polymerase activity of RNA, but the upper, stream of NS5A was correlated with the therapeutic efficacy of IFN.The objective of this research is inhibiting the expression of NS5A protein using RNAi on cellular level. And this study may open a path toward using siRNAs to improve HCV therapy, and can provide theory-based and feasible empirical method. The complete sequence of HCV NS5A region was amplified by PCR from pCDNA3.1 (+)/HCV NS345.According to NS5A sequence′s double predetermination whole structure, three-diamensional structure of NS5A being conventional, which maybe sustain its function. An sequence lying 2209-2248 of NS5A is tightly related to therapy of interferon, so called interferon sensitive decided area (ISDR). One found through ISDR losing mutation that NS5A protein may inhibit protease′s active by interferon inducing, and inhibit phosphorylation of initiate factor 2 of eukaryon organism transcription (EIF-2α), so inhibit initiation of protein translation, ISDR is need accessory among above. In vitro, according to study, NS5A and NS5B have connective active, at the same time, NS5A regulars enzyme active of NS5B by depending on dose, NS5A,NS3 and NS4B formed replication combination, which regular RNA polymerase active of NS5B, so regular virus replication. Study have indicated that HCV NS5A lies in endoplasmic reticulum envelope, which have important role in predetermination of interferon therapy,virus replication, anti-virus,hepatic cancer cell, etc.Our experiment, designed PCR primer direct to NS5A of HCV, constructing eukaryon expression plasmid, with transfection reagent, transfected HL-7702 cell, with transfection reagent construction cell family of stabilizated expression HCV NS5A. Designing directed to 3 target sites of HCV NS5A and constructing expressing siRNA plasmid, We can conclude from our study:1. construction eukaryon recombination expression vector pCI-neo/NS5A.(1) Primer of HCV NS5A region design: At upstream primer 5′site adding gaattc which is EcoR I incision enzyme cutting site and ATG initiate codon, downstream primer 5′site adding acgcgt which is MIu I incision enzyme cutting site and ATT terminate codon. Then, NS5A region gene whole sequence were amplied from including whole long HCV NS345 plasmid by PCR, whole long is hepatic.cell (HL-7702-NS5A.), whole long is 1344bp.(2) Puring NS5A PCR outcome and cloning vector pGEM-T, connection to T/A clone, double enzyme cutting and after measuring sequence were proved right, inserted pCI-neo eukaryon expressing plasmid again, and constructed eukaryon recombination expression plasmid pCI-neo/NS5A. 2. HL-7702 hepatic cell family sustain the expression of HCV NS5A.HL-7702 hepatic cell family (a kind replicon system can sustain HCV more replication, but not infecting virus particle) as model of HCV replication, these replicated factors sustain HCV RNA transcription and protein synthesis, but not generate infected virous. Examining NS5A protein in HL-7702-NS5A expression respectively use Western blot, which proved cell family successfully constructing stable expressing HCV NS5A.HL-7702 hepatic cell family cakins replicon system can sustain HCV more replication, but not infecting virus particle.3. To aim directly at constructing to express siRNA plasmid.Design 3 interfering sites of HCV NS5A6467-6485nt interfering sequence: ggatcgtcggtcctagggac;6977-6995nt interfering sequence: ggacccttgcaccgctaac;7250-7268nt interfering sequence: gccgactacgaaccacct;There are not any same source sequences compared to HCV NS5A: actaccgttgtataggtg is random control.Respectively connection to psilencerTM3.1-H1neo plasmid, named: HCV NS5A R1,HCV NS5A R2,HCV NS5A R3 and HCV NS5A R0.4. HCV NS5A siRNA of the same site plasmid expressions had same inhibition to virus replication and protein expression:HCV NS5A R1,HCV NS5A R2,HCV NS5A R3 and HCV NS5A R0 which are examined right were transfected HL-7702-NS5A cell, at the forth transfection day, NS5A mRNA of HCV NS5A R1,HCV NS5A R2,HCV NS5A R3 examining HCV NS5A protein expression in HL-7702-NS5A cell by western blot, HCV NS5A siRNA of the same site plasmid expressions had same inhibition to virus replication and protein expression, had not affected NS5A mRNA or protein expression. 5. Expressing siRNA plasmid inhibiting the expression of NS5A protein related to dose.In 3.0μg/μl concentration of HCV NS5A R1, HCV NS5A R2, HCV NS5A R3, which were related to dose of replication of NS5A and expression inhibition, this concentration, has inhibition, concentration of expression. During observed concentration degree, random control group R0 had no effect on NS5A replication and protein expression.6. SiRNA targeting HCVNS5A inhibit replication and expression of specific proteinHCV NS5A R1,HCV NS5A R2,HCV NS5A R3,HCV NS5A R0 and pCI-neo/HCV NS5A which are examined right were transfected HL-7702-NS5A cell, at the fourth transfection day, the protein expression of HCV NS5A in HL7702-NS5A is changing by Western blot.HCV NS5A R1 and pCI-neo/HCV NS5A were cotransfected at the fourth transfection day: protein expression of NS5A distinctively declined.Control group R0, however, don't inhibit replication and expression of HCV NS5A in HL-7702 cell. Result indicated: at cell level, plasmid expressing HCV NS5A siRNA had special inhibition of HCV NS5A replication and protein expression.In conclusion, our study used at cell level expressing siRNA plasmid efficient and specially inhibit replication and expressing of HCV NS5A Experiment result indicated among HCV infection in nature, RNAi may become a new virus cleaning way. Therapeutic siRNA along or following use other anti virus drugs may become an instead way of therapy chronic HCV infection in future.
|