Font Size: a A A

Construction And Expression Of Recombinant Cecropin B-LHRH' Gene And Its Anticancer Function

Posted on:2007-02-04Degree:DoctorType:Dissertation
Country:ChinaCandidate:X Y LiFull Text:PDF
GTID:1104360185954770Subject:Obstetrics and gynecology
Abstract/Summary:
IntroductionOvarian cancer has long been one of the most common forms of cancer inwomen,and it is the leading cause of death from gynecologic cancers. The5-year survival rates have not gone up as expected in spite of the advances inthe surgery and systemic chemotherapy, and the effectiveness of chemotherapyhas reached a plateau. This has prompted a search for targeted therapies withhigher efficacy and lesser toxicities.Chimeric proteins are a class of targeted molecules designed to recognizeand specifically destroy cells that overexpress specific receptors. Thesemolecules, designed and constructed by gene fusion techniques, comprise bothcell-targeting and cell-killing moieties.More than 80% of ovarian and endometrial cancers and more than 50% ofbreast cancers express luteinizing hormone releasing hormone receptors(LHRHR). Apart from pituitary cells and reproductive organs (ovaries,fallopian tubes, and uterus) that are normally removed during surgical therapyof ovarian or endometrial cancer, other organs and hematopoetic stem cells donot express LHRHR. The LHRHR is therefore a promising target for atumor-specific gene therapy.In this study, a kind of fusion protein using LHRH'(only with the bindingsite of the LHRH) as the cell-targeting moiety and Cecropin B as thecell-killing moieties was developed, and it is expected to be an efficient incancer targeted chemotherapy for ovarian and endometrial adenocarcinomaover-expressing LHRHR.Materials and methodsConstruction of CB -LHRH' geneThe sequence of the cDNA encoding Cecropin B -LHRH' (CB -LHRH')was designed to combine the cDNA encoding mature Cecropin B and thecDNA encoding the 4th to 10th amino acid residues of LHRH. At the same time,two convenient restriction sites (BamH I and PstⅠ) were incorporated andsome synonymous codons were changed according to the codon usage databaseof Spodoptera frugiperda.The cDNA encoding CB -LHRH' sequence was as follows:GGATCCATGAAATGGAAAGTCTTCAAGAAAATC(ATT)GAAAAAATGGGTCGCAACATTCGAAACGGTATTGTCAAGGCTGGC(GGA)CCC(CCA)GCGATCGCGGTTTTAGGCGAAGCCAAAGCGCTATCG(TCC)TAC(TAT)GGC(GGA)TTG(CTG)AGA(CGC)CCC(CCT)GGC(GGA)TAACTGCAGATG the start codon;TAA the stop codon.GGATCC the Bam HⅠrestriction site;CTGCAG the PstⅠrestriction site.ATC(ATT) ATC the synonymous preference codon;(ATT) the original codon.It was artificially synthesized, cloned to pUC18 plasmid, verified byDNA sequence analysis and transformed into Escherichi coli strain DH5αbyShanghai Sangon Biological Engineering & Technology and Service Co.Ltd.Expression of CB -LHRH' protein by Bac-to-Bac Expression SystemGeneration of baculovirus recombinant for CB -LHRH' geneThe recombinant pUC18/CB -LHRH'was isolated from the amplifiedDH5α, digested with Bam HⅠand PstⅠ, then subcloned into the pFastBacIdonor plasmid. The resultant plasmid, pFastBacI/CB -LHRH', was verifiedby restriction endonuclease digestion and DNA sequence analysis.The pFastBacIrecombinant was transformed into competent E. coliDH10BAC cells, and the gene of interest was transposed into Bacmid throughlacZ gene disruption. White colonies, containing the recombinant Bacmidswere selected on Luria agar, containing kanamycin, tetracycline, gentamycin,bluo-gal, and IPTG.. Recombinant Bacmids were purified and genomic insertswere demonstrated by PCR.According to the manufacture's instructions, Sf9 cells were transfectedwith recombinant Bacmid and the empty Bacmid respectively usingLipofectamine reagent, and the transfections were verified by examining thebaculovirus under electronic microscope. The infective titers were determinedby the plaque assay and the virus was emplified for expression studies.Expression and identification of CB -LHRH' proteinProteins were identified in Western dot blots of the lysates of recombinantvirus-inoculated Sf9 cells. Rabbit polyclonal antibody to LHRH was used asprimary antibody, and peroxidase-conjugated affinipure goat anti-rabbit IgGwas used as secondary antibody.To examine the activity of the CB -LHRH' protein, the lysates ofrecombinant virus-inoculated Sf9 cells was tested, the lysates of emptyvirus-inoculated Sf9 cells and the lysates of empty Sf9 cells were used forcontroles. The expected antibacterial activity of the CB -LHRH' proteinwere determined by inhibition zone assay against DH5α. To determineanticancer effects of the CB -LHRH' protein, ovarian cancer cell line SKOV-3(LHRHR negative) and endometrial adenocarcinoma cell line HEC-1-B (LHRHRpositive) were treated by different doses of the three kinds of the Sf9 lysates,and cell growth inhibition assay was performed using the XTT kit at differentperiods.ResultsThe fusion protein CB-LHRH was expressed by the Bac-to-Bac BaculovirusExpression System successfully.The lysates of recombinant virus-inoculated Sf9 cells, the lysates ofempty virus-inoculated Sf9 cells and the lysates of empty Sf9 cells all showeda potent antibacterial activity against DH5α. The lysates of empty Sf9 cellsshowed stronger antibacterial activity than the two kinds of virus-inoculatedSf9, and the last two showed equal antibacterial activity.All of the Sf9 lysates showed dose-dependent and time-dependent, andthe empty Sf9 lysates always showed stronger anticancer activity than theempty virus-inoculated Sf9 lysates. So the empty Sf9 lysates were selected asthe controle.The empty Sf9 lysates showed stronger anticancer activity than therecombinant virus-inoculated Sf9 lysates against the SKOV-3 cells (LHRHRnegative). However, to the LHRHR positive cell line HEC-1-B, the formerwas weaker than the latter. On the other hand, to the empty Sf9 lysates, therewere no difference between the anticancer activities against the two kinds ofcancer cell lines. To the recombinant virus-inoculated Sf9 lysates, theanticancer activity against the HEC-1-B was stronger than that of the SKOV-3.DiscussionCecropin B is the first antimicrobial peptide characterized from animalsin 1980. Since then, there has been an increasing interest in the antimicrobialpeptides and thousands of molecules have been isolated widely from mammals,birds, amphibians, insects, plants and microorganisms. Antimicrobial peptidesare thought to be key effector molecules in the innate immunity that areparticularly important in early defense against invading microorganisms, aspointed out by Boman, antimicrobial peptides are an ideal first line of defense.Irrespective of their origin, spectrum of activity and structure, most ofthese peptides share several common properties. They are generally composedof 15~45 amino acid residues, their net charge is positive, they arehydrophobic and/or amphiphilic, and in most cases they are membrane active.Antimicrobial peptides can be divided to several groups based on theirstructure, spectrum of activity and mode of action. Cecropins, usuallycomposed of 35~39amino acid residues, is one of the important groups.As the first step of self-defense against invading pathogenicmicroorganisms, the antimicrobial peptides possess the following four features:selective toxicity, fast killing, broad antimicrobial spectra and no resistancedevelopment. Further more, cecropins are highly potent against cancer cellsbut not against normal mammalian cells. The antimicrobial and anticancermechanisms were generally suggested as plasma membrane disruption viamicellization or pore formation by peptide-lipid interaction. Their short length,fast and efficient action against microbes and low toxicity to mammals havemade them potential candidates as peptide drugs.In this study, the results of the inhibition zone assays suggest that fusionprotein CB-LHRH 'possess the antibacterial activity of the CB, which implythat the antimicrobial peptides can be largely produced by Bac to Bacexpression system. The results of the cell growth inhibition assays suggest thatthe CB-LHRH ' protein has the anticancer activity, and it may play itsanticancer function through the binding of the LHRH' to the LHRHR.CB-LHRH ' protein may be expected to be a potential candidates as peptidedrugs for targeted cancer therapy.ConclusionFirst, the CB-LHRH protein was expressed by the Bac-to-Bac expressionsystem successfully, which suggests that the antimicrobial peptides can belargely produced by molecular biological techniques and cell culturetechniques. Second, the CB-LHRH ' protein possess the antibacterial activity.Third, the CB-LHRH ' protein has the anticancer activity, and it may play itsanticancer role through theLHRHR. Thus, CB-LHRH ' protein may beexpected to be a potential candidates as peptide drugs for targeted cancertherapy.
Keywords/Search Tags:Cecropin B-LHRH', Bac-to-Bac expression system, anticancer activity
Related items