| (1)Dematiaceous fungi (Dematiaceae) are a large and diverse group of hyphomycete that has typical morphology and is observed as asexual forms. They have been isolated as saprobes, and a few of them may be pathogenic to human and animals. The most important pathogenic agents to human are Fonsecaea pedrosoi, Fonsecaea compacta, Phialophora verrucosa, Wangiella dermatitidis, Cladosporium carrionii and Exophiala jeanselmei , which cause chromoblastomycosis, Phaeohyphomycosis, and eumycotic mycetoma. Over the past decades the systematics, the nomenclature and the identification of Dematiaceae have been Confusing and controversial, and they are regarded as the most complicated and difficult in the field of medical mycology. The key is that the phylogenetic relationships among this family is not well-understanding, and so the reliable, complete and accurate natural taxonomic system is not well established.In this study, a fragment of 18s rDNA gene sequence(GCATCACAGACCTGTTATTGCCTC, 24bp) which is highly conserved in at least 18 species of fungi was used as primer, and the genomic DNAs of six species of thirty strains of medically important dematiaceous fungi mentioned above were used as template for arbitrary amplification. Amplification reactions were performed in volumes of 30μl containing 3μl 10×PCR buffer, 3μl MgCl2 (25mmol/L), 3μl dNTPs (each 2. 5mmol/L),... |