Font Size: a A A

Study On The Protective Effects And Mechanisms Of Grape Seed Procyanidins On Cerebral Ischemia-Reperfusion Injury In Mice

Posted on:2007-07-20Degree:DoctorType:Dissertation
Country:ChinaCandidate:X X WuFull Text:PDF
GTID:1104360182992322Subject:Pathology and pathophysiology
Abstract/Summary:
AimCerebral vascular disease is one of the most important diseases which are harm to our health. Ischemic brain infarction accounts for 60% -80% cerebral vascular disease and possesses the specialty of high incidence of a disease, the disabled and recrudescence. Treat it with thrombolytic agents can make prominent curative effect, but induce cerebral ischemia - reperfusion injury which influence prognosis of some patients badly at the same time. Therefore, it is an a-cute problem to seek a new effective measure to prevent or to treat cerebral ischemia - reperfusion injury. The mechanisms underlying cerebral ischemia -reperfusion injury are very complex and still poorly understood. Energy failure, excitotocity, calcium overload, free radicals injuries, inflammation and nitric oxide are consider to be implicated in them. Recently, increasing attention has been focused on the role of free radicals, inflammation and the cytotoxicity of NO in the pathogenesis of brain ischemia - reperfusion injury. By far, the effective drugs treating cerebral ischemia - reperfusion injury have not been found in clinical though many efforts have been made. Grape seed procyanidin (GSP) have been reported to possess a broad spectrum of biological, pharmacological and therapeutic properties such as: an eliminating free radicals and antioxidant activities ( GSP had significantly better free radical scavenging ability than vitamins C, E) , a cardioprotective property (including anti - platelet effect, a car-dioprotective effect against ischemia reperfusion injury, an inhibition cardiomyo-cyte apoptosis activity, etc) and an anti -inflammatory effect and so on. These properties and abundant source prompted us to investigate whether it has any protective effects in brain ischemia reperfusion injury and we hope it to be developed a new drug to prevent and treat brain ischemia reperfusion injury. Thepresent experiment was undertaken to observe whether GSP possessed protective role against brain ischemia, hypoxia and reperfusion injuries and to explore its mechanisms of protective action.Methods1 Animal model establishment1. 1 Normabaric hypoxia modelKunming mice were randomly divided into five groups. The mice were injected ip GSP 10,20,40mg/kg and nimodiping (Nim) 2 mg/kg, while the mice in control group were given the same volume distilled water. After 25min, a mouse was put into a 150ml close bottle with lOg Soda - lime. A measuring cylinder with some water was prepared. A conduit was put into the measuring cylinder, the conduit was connected with the glass pipe of a hypoxic bottle by a glue pipe. Along with the time lapse, water surface in conduit would increase when the mouse breathed. The decline milliliter of water surface in measuring cylinder is regarded as amount of oxygen consumption. Survival time was recorded. Meanwhile, amount of oxygen consumption after putting a mouse into a 150ml close bottle 10,20,30min were observed.1. 2 Hypoxia after decapitationDividing groups and drug administer are the same as above. After 25min, each mouse was decapitated along the ear root and gasping duration data of each after decapitation was recorded.1. 3 Acute incomplete cerebral ischemia modelKunming mice were randomly divided into five groups. The mice were injected ip GSP 10,20,40mg/kg and nimodiping (Nim) 2 mg/kg, while the mice in control group were given the same volume distilled water. After 25min, animals were anesthetized with ether. Then they were incised through median incision of the neck, bilateral carotid arteries were ligatured with vagi and survival time was recorded.1.4 Cerebral ischemia - reperfusion modelThe mice were anesthetized with ether, and then were incised through me-dian incision of the neck. The bilateral common carotid arteries were then occluded by microaneurysm clips for 30 minutes, after removing the clips, return of flow was visualized in the arteries. The mice in GSP or Nim treated group were injected GSP or Nim 10, 20,40, 2 mg/kg body mass respectively during the bilateral common carotid arteries occlusion and again at 24 hours after reperfusion, while the mice in sham control group ( bilateral common carotid arteries were exposed without occlusion) were injected the same volume distilled water.2 Indexes measurement2.1 The measurement of superoxide dismutase (SOD) , catalase (CAT) and nitric oxide synthase ( NOS) activities and the content of nitric oxide (NO) , malondialdehyde (MDA) and total antioxidative capacity (T -AOC) of brain tissue72 hours after reperfusion, the skulls of mice in each group were opened to get whole brain and to put them on an ice dish. 10% tissue homogenate was made with saline and then 4^ centrifuged, supernatant were taken out, SOD, CAT and NOS activities and content of NO, MDA and T - AOC of brain tissue were measured according to test kits.2. 2 Pathological examination72 hours after reperfusion, the mice were anesthetized with 10% Urethane ( lg/ml) and transcardially perfusion - fixed with 4°C 4% buffered formaldehyde 200ml after a brief rinse with saline at room temperature. The brains were removed , kept in cold fixative for 12 hours. Coronal slices were made and stained with versyl violet. The pathological changes of field CAl of hippocampus were observed by light microscope.2. 3 The measurement of Evans blue content in brain tissueBefore 1 hour of mouse death, 2% Evans - Blue (EB) dye (5 ml/kg) was injected into the tail vein. Several seconds after injection, the conjunctivas and limbs turned blue, indicating a successful injection. The chest was opened 20 minutes later and the brain was transcardially perfused with 200 ml saline through the left ventricle at 100 mmHg pressure until the colorless perfusion fluid was obtained from the right atrium. After decapitation, brain tissue samples were obtained and weighed. Then, the samples were placed in formamide solu-tion and incubated for 48 hours at 451. The optical density (OD) of the EB formamide solution was determined by 721 spectrophotometers at 620 nm.2.4 Monitoring of regional cerebral blood flow by Laser Dopper Flowmetry. The mice were anesthetized with 10% Urethane( lg/ml) ip, a 2 -3mmhole was drilled 3mm caudal to bregma,3mm right lateral to the midline. Regional cerebral blood flow were measured by Laser Dopper Flowmetry ( LDF -PF3, Perimed, Sweden) with a probe placed at the surface of meninges vertically after reperfusion 72 hours.2.5 Cytokines and MMP-2, MMP-9 measurement 2.5. 1 Cytokines measurement by ELISA methodBlood in eye socket was collected in EP tube. The plasma was collected after rested 6 hours at 4°C and analyzed for the presence of IL - 13 and IL -10 u-sing ELISA kits. 72 hours after reperfusion, the skulls of mice in each group were opened to get whole brain and to put them on an ice dish. 10% tissue ho-mogenate was made with saline and then 4^1 centrifuged, supernatant were taken out to measure the contents of IL - 1(3 and IL - 10 using ELISA kits.2. 5. 2 Measurement expression of cytokines and MMP -2, MMP-9 by RT -PCRTotal RNA extraction and reverse transcription;Total RNA was isolated from field CA1 of hippocampus according to RNAout kit. For cDNA synthesis, lOfjd reverse transcription mixture containing 0. 6 jxl (0. 8jxg) total RNA sample, 0.5ui Radom 9 mers, 1 jxl dNTP Mixture, 0. 25fjd RNase Inhibitor, 0.5jxl AMV Reverse Transcroptase and 1 ui 10 x RT Buffer. The mixture was incubated at 30^ for lOmin ,at 50^ for 30 min ,at 99t for 5 min ,at 5X for 5 min according to the TakaRa RNA PCR kit [ ( AMV ) Ver3. 0 ].PCR procedure: PCR reactions were then performed using primers for (3 -actin, IL-1(3, TNF-a, MMP-2 and MMP-9. IL-ip:sense 5' - GAGAT-TGAGCTGTCTGCT - 3*, antisense 5' - AAGGAGAACCAAGCAACGAC - 3* 313 bp;TNF - a: sense 5' - CCACCATCAAGGACTCAA - 3', antisense 5' -GTCACCAAATCAGCGTTA - 3', 456 bP;MMP - 2: sense 5' - CAACGATG-GAGGCACGAGTG - 3', antisense 5' - GCCGGGGAACTTGATGATGG - 3', 448 bp;MMP - 9: sense 5' - CTTTGAGTCCGGCAGACAAT - 3', antisense 5'- TTCCAGTACCAACCGTCCTT -3,460 bp. Five jxl each of reverse transcription solution was added to PCR mixture containing 5|xl 5 x PCR Buffer, 0.125jxl TaKaRa Ex Taq HS, 0.25 jxl each of the primers in a total volume of 25jjJ. The PCR conditions for IL - 1(B were as follows: 3 min at 94°C ,then step at 94X1 30sec,30sec at 58*0 ,lmin at 72*0 , and a 7min final extension at 72X1. The PCR conditions for TNF - a were as follows: 3 min at 94X1 , then step at 94X1 30sec,30sec at 55*1! ,lmin at 72X1 , and a 7min final extension at 72X1. The PCR conditions for MMP -2 were as follows;3 min at 94XI ,then step at 94Xl 30sec,30sec at 56X1 ,lmin at 72X1, and a 7min final extension at 72X1. The PCR conditions for MMP -2 were as follows;3 min at 94X1 ,then step at 94X1 30sec,30sec at 46X1 ,lmin at 72X1, and a 7min final extension at 72X1. PCR reactions for (3 - actin, IL - 1 £, TNF - a, MMP - 2 and MMP - 9 were allowed to cycle 35 times. Five jxl PCR products were fractionated on a 2% agarose gel and stained by ethidium bromide and visualized upon exposure to ultraviolet light. Pictures of the agarose gels were taken and scanned and analyzed using Scion Image analysis system. OD values for each individual fragment were normalized to |3 - actin expression from the same tissue sample.2.6 Statistical analysesData are expressed as Mean ± SD, and assessed by one - way ANONA a-nalysis. A P value of <0.05 was taken as significantResults1. Effects of GSP on survival time and oxygen consumption;Compared with control group, GSP (10, 20, 40 mg/ kg) significantly prolonged the survival time, and decreased oxygen consumption in mice subjected to normabaric hypox-ia(P<0.01).2. Effects of GSP on persistent time of gasping;Compared with control group, GSP and Nim significantly prolonged the persistent time of gasping ( P < 0.01).3. Effects of GSP on acute incomplete cerebral ischemia;Compared with ischemia group, GSP and Nim significantly prolonged survival time in mice sub-jected to acute incomplete cerebral ischemia (P <0.01).4. Effects of GSP on contents of EB in brain tissue in cerebral ischemia -reperfusion mice: The content of EB in brain tissue in ischemia - reperfusion group is increased as compared with those in the sham control group. GSP and Nim could decrease the content of EB in brain tissue (P <0.01).5. Effects of GSP on regional cerebral blood flow (rCBF) in cerebral ischemia - reperfusion mice: rCBF was decreased after reperfusion 72h as compared with those in the sham surgery group ( P <0. 01). GSP (40mg/kg) and Nim could increase the rCBF to the different extent ( P <0. 05, P <0.01).6. Effects of GSP on T - AOC, NOS, SOD, CAT activities and NO, MDA formation of brain tissue in cerebral ischemia - reperfusion mice : GSP was found to increase the SOD and CAT, enhance T - AOC and reduce the content of NO, NOS, MDA in brain homogenate in cerebral ischemia and reperfusion mice(P<0.01).7. Effects of GSP on levels of IL - 13 and IL - 10 in serum and brain tissue in cerebral ischemia — reperfusion mice;The levels of IL — 1 {3 in serum and brain tissue were significantly increased ( P <0. 01) , but the levels of IL - 10 were decreased but P > 0. 05, as compared with those in the sham surgery group. The levels of IL - 113 in serum and brain tissue in the GSP and Nim treated group had different decrease while the levels of IL - 10 had different increase as compared with those in the ischemia - reperfusion group ( P < 0. 01).8. Effects of GSP on expressions of TNF - a, IL -1 (3 in area of hippocampus in cerebral ischemia - reperfusion mice-. TNF - a, IL - 1(3 expressions in area of hippocampus were increased markedly as compared with those in the sham surgery group( P <0.01). TNF - a, IL - 1 (J expression in area of hippocampus in the GSP and Nim treated group had different decrease as compared with those in the ischemia - reperfusion group ( P <0.01).9. Effects of GSP on MMP -2,9 expressions in area of hippocampus in cerebral ischemia - reperfusion mice: The levels of MMP -2,9 expressions in area of hippocampus were increased after cerebral ischemia reperfusion (P <0. 01), different doses of GSP and Nim could decrease the levels of MMP - 9 expression to different degree (P <0. 01) , but they had no effect on the level ofMMP - 2 expression ( P > 0.05 ).10. Effects of GSP on pathological changes in area of hippocampus in cerebral ischemia - reperfusion mice: Pathological examinations showed that in control group, neuronal cells membrane was visible and integrate, its shape was maintained and had no edema. Nucleoli could be seen clearly. Otherwise, in ischemia reperfusion group, neuronal cells swollen and its shape was not maintained. Cell membrane was invisible. Nucleoli were deep stained and pyknosis and abnormity. Interstitial space appeared edema and widen. GSP and Nim could ameliorate Nucleoli deep stained and abnormity, decrease cell and interstitial edema, and increase the number of neuronal cells with normal shape, visible nucleoli to a different degree.Conclusions1. GSP could significantly prolong the survival time, persistent time of gasping and decreased oxygen consumption in mice subjected to acute anoxia and ischemia. This suggested that GSP exerted a protective effect on the cerebral ischemia and anoxia.2. GSP could ameliorate eccentric pycnotic nuclei, intracellular edema, increased the numbers of cells with normal cytoarchitecture. This indicated that GSP had a protective effect on brain ischemia reperfusion injury.3. GSP could protect blood brain barrier integrality by reducing increased the permeability of blood - brain barrier (BBB) inducing by brain ischemia reperfusion.4. The protective effects of GSP on cerebral ischemia reperfusion injury may be related to follows;(1) GSP was found to reduce NOS activities and formation of NO, MDA, to increase the SOD and CAT, enhance T - AOC and protect against cytotoxicity of NO.(2 ) GSP was found to increase the level of antiinflammatory cytokine such as IL -10, and reduce the levels of proinflammatory cytokines such as TNF - a, IL -1 (3 contents or expression, reduce inflammatory reaction.( 3 ) GSP could protect blood brain barrier structural integrality by reducing degradation of cerebral capillary basal membrane.(4) GSP had the role of increasing blood flow in cortex in brain ischemia reperfusion mice.
Keywords/Search Tags:cerebral ischemia reperfusion, grape seed procyanidin, cyto-kines, matrix metalloproteinase, antioxidation enzymes, nitric oxide synthase, nitric oxide, Evans blue, cerebral blood flow, blood brain barrier
Related items