Font Size: a A A

Study On Expression Property And Anti-tumor Effect Of PEgr-sPEX Induced By Ionizing Radiation

Posted on:2006-04-27Degree:DoctorType:Dissertation
Country:ChinaCandidate:G Q WangFull Text:PDF
GTID:1104360155953539Subject:Otorhinolaryngology
Abstract/Summary:
Radiotherapy is important in the treatment of many human cancers, but it is often unsuccessful because of tumor cell radiation resistance and damage of immune and hemopoietic system. So it is urgent to enhance the radiotherapeutic effects and reduce recurrence and metastasis of tumor. According to the mechanism that ionizing radiation can activate early growth response-1 (Egr-1) gene promoter and induce the expression of downstream genes, the researchers in Harward and Chicago university first combined gene therapy with radiotherapy in order to enhance radiotherapeutic effects. At the present, To further enhance anti-tumor effects many researchers focus on how to select effective theraputic genes used in gene-radiotherapy. On the basis of inhibitory effect to degradation of extra-cellular matrix and anti-angiogenic effect of PEX, we cloned mouse secretory PEX gene (sPEX), constructed recombinant plasmid pEgr-sPEX and studied expression property and anti-tumor effect of pEgr-sPEX induced by radiation and its mechanism. 1. Cloning and identification of mouse sPEX cDNA Designed and synthesized two pairs of primers of sPEX cDNA according to its sequence in Gene Bank: (1) Sig-F: 5'GCTAGCATGGAGGCACGAGT GGCCTG3', Sig-R:5'ACAATGTCCTGTTTGCAGATAGCGATGGCGCGG CCCAACA3'; (2) PEX-F: 5'AT CTGCAAACAGGACATTGT3', PEX-R: 5'CTCGAGGCAGCCC AGCCA GTCTGATT3'. Total RNA was extracted from NIH3T3 cells. Sig-F/Sig-R and PEX-F/ PEX-R primers were used respectively to amplify Sig and PEX cDNA with RT-PCR. Sig-F/PEX-R primers were used to amplify sPEX cDNA with Combined PCR technique. sPEX cDNA was cloned into plasmid pMD18-T. Sequencing analysis proved that sPEX cDNA were completely correct. 2. Construction and identification of recombinant plasmid pEgr-sPEX Plasmid pMD18-T-sPEX was digested by HidⅢand KpnⅠto obtain sPEX cDNA. sPEX cDNA was inserted into the MCS of plasmid pcDNA3.1-Egr to construct recombinant plasmid pEgr-sPEX. After pEgr-sPEX was digested by BamHⅠand BstXⅠ, Electrophoresis showed the recombinant plasmid was constructed correctly. 3. Expression property of recombinant plasmid pEgr-sPEX induced by ionizing radiation 3.1 Expression of PEX induced by different doses X-ray in B16 cells transfected by pEgr-sPEX Plasmid pEgr-sPEX was packed with liposome to transfect B16 cells. 24h later, the cells were irradiated by 0, 1, 2, 5 and 10Gy X-ray in vitro. 12h after irradiation, the total RNA was extracted from the cells and mRNA expression level of sPEX was detected with RT-PCR. The results showed that mRNA expression level of sPEX after different doses of X-rays were obviously higher than that of sham-irrad group, sPEX mRNA level increased in dose-dependant manner within 5Gy and the highest level was 6.77 times of that of sham-irrad group. sPEX mRNA expression could not be detected in cells without transfection or transfected with blank plasmid. The results indicated that ionizing radiation could activate Egr-1 promoter to induce its down-stream gene expression, and the expression increased in dose-dependant manner within certain doses. Plasmid pEgr-sPEX had enhanced expression property induced by radiation. After 5 Gy X-ray irradiation, the expression of PEX reached the highest and it decreased after 10 Gy X-ray irradiation, which perhaps was associated with damage caused by high dose X-ray irradiation. Plasmid pEgr-sPEX was packed with liposome to transfect B16 cells. 24h later, the cells were irradiated by 0, 1, 2, 5 and 10Gy X-ray in vitro. 24h after irradiation, the supernatants were collected to detect PEX protein with Western blot. The results showed that sPEX protein could be detected in cells transfected by pEgr-sPEX, but could not be detected in cells without transfection or transfected with blank plasmid. The results indicated that ionizing radiation could activate Egr-1 promoter to induce its down-streamgene expression, and the signal peptide designed by us could introduce sPEX protein secreting outside from the cells. 3. 2 The expression of PEX at different time after 2Gy irradiation pEgr-sPEX was packed with liposome to transfected B16 cells. 24h later, the cells were irradiated by 2Gy X-ray. Total RNA was extracted from the cells and mRNA expression level of sPEX was detected with RT-PCR 0, 4, 8, 12, 24, 48 h after irradiation. The results showed that mRNA expression level of sPEX at different time after 2Gy irradiation were obviously higher than that of sham-irradiation group, sPEX mRNA level increased within 24 h and decreased 48 h after irradiation though still higher than that of sham-irradiation group. The results suggested that sPEX protein could be secreted outside from the cells and accumulate in the supernatants. 4. Effect on B16F10 Cells invasion and HUVEC canaliculus formation of pEgr-sPEX transfection in vitro combined with radiation 4.1 Effect on B16F10 Cells invasion of pEgr-sPEX transfection in vitro combined with radiation Boyden chamber assay showed that invasion capability of B16F10 Cells transfected by pEgr-sPEX combined with radiation or not was significantly lower than that of control group(P<0.05~0.01); Invasion capability of B16F10 Cells transfected by pEgr-sPEX combined with radiation was significantly lower than that of B16F10 Cells transfected by pEgr-sPEX(P<0.01); There is no difference between radiation alone group and control group. The results suggested that 2Gy X-ray irradiation had no effect on invasion capability of B16F10 Cells, but after transfected by pEgr-sPEX, invasion capability of B16F10 Cells was significantly reduced, especially combined with radiation. 4.2 Effect on HUVEC canaliculus formation of pEgr-sPEX transfection in vitro combined with radiation We designed a conditioned culture medium experiment to evaluate the effect on HUVEC canaliculus formation of pEgr-sPEX transfection in vitro combined with radiation. The results showed that the quantity of HUVEC canaliculus formation of bFGF group was significantly more than that of control group(P<0.01); The quantity of HUVEC canaliculus formation ofbFGF group was significantly more than that of bFGF+ B16/2Gy group, bFGF+ B16-sPEX group and bFGF+ B16-sPEX /2Gy group(P<0.05~0.01); The quantity of HUVEC canaliculus formation of bFGF+ B16-sPEX /2Gy group was significantly lower than that of bFGF+ B16/2Gy group(P<0.01) and bFGF+ B16-sPEX group(P<0.05). The results suggested that 2Gy X-ray irradiation and PEX gene could inhibit the stimulative effect of bFGF on HUVEC canaliculus formation. In addition, X-ray irradiation and PEX gene could cooperate synergically. 5. Effect on MMP-2 activation of B16F10 Cells of pEgr-sPEX transfection in vitro combined with radiation We used glutin enzymatic chart analysis to evaluate the effect on MMP-2 activation of B16F10 Cells of pEgr-sPEX transfection in vitro combined with radiation. Experimental groups included: collagenⅠ; collagenⅠ+ B16; collagenⅠ+ B16/2Gy; collagenⅠ+ B16-sPEX; collagenⅠ+ B16-sPEX/2Gy. The results showed that MMP-2 and MMP-9 zymogen were detected in collagenⅠgroup; MMP-2, MMP-9 zymogen and activated MMP-2 were detected in collagenⅠ+ B16group and collagenⅠ+ B16/2Gy group; MMP-2 zymogen were detected in collagenⅠ+ B16-sPEX group and collagenⅠ+ B16-sPEX/2Gy group. The results suggested that cooperation of B16F10 Cells and collagenⅠcould stimulate the activation of MMP-2, which could be inhibited by PEX gene. 2Gy X-ray irradiation had no effect on the activation of MMP-2. 6. Anti-tumor effect of pEgr-sPEX gene-radiotherapy in vivo Mice were implanted with melanoma cells. 100ul pEgr-sPEX recombined plasmids mixed with liposome were injected into tumor when tumor diameter was about 5mm. 24h later, tumors were irradiated with 2Gy X-ray every other day for three times. Experimental groups included: (1) control group; (2) 2Gy X-ray group; (3) pEgr-sPEX group; (4) pEgr-sPEX/2Gy group. Tumor growth rate of experimental groups were observed. The results showed that tumor growth rate of control group was highest, and pEgr-sPEX/2Gy group were lowest. 6-15d after irradiation, tumor growth rate of 2Gy X-ray group, pEgr-sPEX group and pEgr-sPEX/2Gy group obviously lower than that of sham-irradiation group (p<0.05~0.01), and that of pEgr-sPEX/2Gy group wassignificantly lower than 2Gy X-ray group and pEgr-sPEX group (p<0.05~0.01). There was no significant difference between 2Gy X-ray group and pEgr-sPEX group. 15d after irradiation, tumor volume of sham-irradiation group was 43.32 times bigger than the volume before irradiated, that of 2Gy X-ray group and pEgr-sPEX group were respectively 20.89 and 17.54 times bigger than that before irradiated, but that of pEgr-sPEX/2Gy group was 3.43. The results suggested that pEgr-sPEX gene-radiotherapy could significantly inhibit growth of melanoma cells, and its anti-tumor effect was better than that of gene therapy and radiotherapy. 7. The mechanism of anti-tumor effect of pEgr-sPEX gene-radiotherapy in vivo 7.1 mRNA level of PEX in tumor Tumor bearing mice were injected with pEgr-sPEX plasmids, then given 2 Gy X-ray irradiation locally. 48h later, total RNA was isolated from tumor cells. mRNA level was detected by semi-quantity RT-PCR. The results showed that all groups had Gapdh mRNA expression, but only pEgr-sPEX group and pEgr-sPEX/2Gy group had PEX mRNA expression. mRNA level of pEgr-sPEX/2Gy group was higher than that of pEgr-sPEX group. The results suggested that after transfected by pEgr-sPEX plasmids in vivo, tumor cells expressed PEX which had strong anti-tumor biological function. After irradiation, Egr-1 promoter was activated to induce its down-stream PEX gene expression, thus enhanced the inhibitory effect to degradation of extra-cellular matrix and anti-angiogenic effect of PEX. 7.2 Effect on intratumoral micro-vessel density of pEgr-sPEX gene-radiotherapy in vivo IMVD was determined as a single microvessel count in a 200 x microscope field from the region of the tumour that appeared to be most densely vascular(hot spots). IMVD of control group were significantly higher than that of other groups(P<0.05~0.01). IMVD of pEgr-sPEX/2Gy group was significantly lower than that of 2Gy X-ray group and pEgr-sPEX group (p<0.01). There is no significant difference between IMVD of 2Gy X-ray group and pEgr-sPEX group. The results suggested that both X-ray and PEX could inhibit angiogenesis in tumor, and they can cooperate together.
Keywords/Search Tags:PEX gene, Egr-1 promoter, recombinant plasmid pEgr-sPEX, transfection, ionizing radiation, anti-tumor effect, angiogenesis
Related items