Experimental Study Of TNF-Related Apoptosis-Inducing Ligand On Human Bladder Cancer | | Posted on:2006-07-02 | Degree:Doctor | Type:Dissertation | | Country:China | Candidate:S Y Wang | Full Text:PDF | | GTID:1104360155467057 | Subject:Surgery | | Abstract/Summary: | PDF Full Text Request | | Part â… CONSTRUCTION AND IDENTIFICATION OFEUKARYOTIC EXPRESSION VECTOR OFHUMAN TRAIL GENEObjective: To acquire TRAIL full length gene cDNA by the mean of RT-PCR. Constructing TRAIL gene eukaryotic expression vector pcDNA3.1-TRAIL.Methods: Collecting Jurkat lymphoma cancer cells 3×10~6. TRAIL gene was amplified from the mRNA of Jurkat cells by the way of RT -PCR . Underwenting the PCR reaction with dNTP and Taq enzymes acording to the cDNA seqence . Cloned intoeukaryotic expression vector pcDNA3.1 which was digested by the same enzymes . Up premier is5 ' AGAATTCAGGATCATGGCTATGATGG3 ' ; down premier is 5 ' GAAGCTTCCAGGTCAGTTAGCCAACT3 ' .PCR product was digested by rectriction endonuclease EcoR â… and Hind â…¢.The digested product was extracted and ligated with the plasmid pcDNA3.1 by T4 ligase over night ,to construct the eukaryotic plasmid pcDNA3.1-TRAIL.pcDNA3.1-TRAIL was digested by EcoR â… and Hind â…¢,and the result was proved by electrophresis.ResuIts:A 900bp cDNA was amplified by RT-PCR and the sequencing resultproved it was TRAIL full length. The eukaryotic expression vector pcDNA3.1-TRAIL was digested with EcoR I and Hind III,and two fragments 5.5kb and 900bp were got indicating that the plasmid was correct.Conclosion: TRAIL gene has been cloned .The eukaryotic expression vector pcDNA3.1- TRAIL has been constrcted successfully .part IIEXPERIMENTAL STUDY OF TNF-RELATEDAPOPTOSIS-INDUCING LIGAND ON HUMAN BLADDERCANCER CELL STRAIN IN VITRO.Objective:To examine apoptosis drug (TRAIL)on inhibition action of bladder cancer cell strain T24. Studing its exspression in human bladder cancer line.Methods:.Plasmid pcDNA3.1-TRAIL was transferred into human bladder cancer cell T24 by Lipofectamine 2000,and Weston-blot detected its expression.Underwent the vitro culture of human bladder cancer cell strain T2.4. Examining the growth inhibitory rate of TRAIL with bladder cancer cell strain T24 byMTT,drawing growth inhibition carve ,(CGC), Comparing the inhibiting action ofTRAIL on cell strain T24 with cisplatin(cDDP); determining the apoptosis and the changes of cell cycle by flow cytometry (FCM);Results: TRAIL inhibited the growth of human bladder cancer cell strain T24 significantly, with time dependence(p<0.05). TRAIL could be exspressed in human bladder cancer cell line.? TRAIL had its killing activity in an acting time of 24h, 48h, 721k 96 hours ,the growth inhibition rate(GIR) of it to cell strain T24 were 9.3%, 14.8%,24.36%, 34.37% respectively;(2)The growth inhibition rate(GIR) of cDDP to cell strain T24 at the concentration of 3umol/L, at the acting time 24h, 48h,72h, 96h were 22.61%, 30.28%, 40.19%, 46.37 %;?The growth inhibition rate(GIR) of the combined therapy of TRAIL and 3umol/l cDDP to cell strain T24 at the acting time of 24h, 48h, 72h, 96h were 27.53%, 37.34%, 48.32%, 56.82%; The combination effect was significantly higher than the simple effect.The cell strain T24 presented cell apoptosis peak of subdiploid before the Gl phase of cell cycle. TRAIL can selectively induce the cell apoptosis in S phase.Conclusions :?TRAIL inhibited the growth of human bladder cancer cell strain T24 significantly, with time dependence .?The growth inhibition rate(GIR) of combination of TRAIL and cDDP was higher than their simple effect.(3)TRAIL can induce the apoptosis of cells. TRAIL could be exspressed in human bladder cancer cell line.Part IIIEXPERIMENTAL STUDY OF TNF-RELATEDAPOPTOSIS-INDUCING LIGAND ON ACTION FORCURTURE OF HUMAN BLADDER CANCER IN VIVOObjective: Established bladder carcinoma cell strain T24 transplantation tumor model of BALB/c-nu nude mice. To explore the treatment action and acting mechanism of TRAIL on the subcutaneous transplantation tumor in BALB/c-nu nude mice of human bladder carcinoma cell strain T24.Methods:l. Established bladder carcinoma cell strain T24 in transplantation tumor model of BALB/c-nu nude mice.BALB/c-nu nude mice (4-6 weeks age) were used, bladder carcinoma cell strain T24 was cultured in vitro. T24 were injected subcutaneously in the right lower limb of nude mice; When the volume of the subcutaneous transplantation tumor reached 0.25cm3 (the maximal diameter X the minimal diameter') ,dividing them into four groups at random: A(TRAIL), B( TRAIL plus lower concentration cDDP) ? C(cDDP),D(Normal NS ); Observing the formation tumor rate, tumor growth rate, survival duration and survival prolongation duration of each group.Results: 1 .The establishment of human bladder carcinoma cell strain T24 nude mice model is success, the formation tumor rate of bladder carcinoma cell strain T24 in transplantation tumor model of nude mice was 100%. the TRAIL and cDDP both can inhibit the growth of carcinoma and promoted the survival duration of T24 as the survival prolongation duration rate (11.26% > 53.16%and 38.98%). The survival duration of A(TRAIL)and B (TRAIL plus lower concentration cDDP) had significant diference compared with C(cDDP) and D(Normol NS) (p<0.05) 4 weeks after therapy ,the survival duration of control group of subcutaneous transplantation tumor group was 23.23days .the survival duration was 26.38days(A group)> 35.68days(Bgroup) ^ 32.73days(C group)> respectivly? The weight of tumor was 3.73g±1.14g^ 2.49g± 1,18g 2.78g± 1.34g, 5.49g± 1.08g respectively.Conclusion: CD The established transplantation tumor model of bladder carcinoma cell strain T24 in nude mice has the character of high formation tumor rate. ?TRAIL can significantly inhibit T24 transplantation tumor in nude mice,TRAIL can significantly decrease the formation rate and mortality rate of nude mice,prolong their survival duration. | | Keywords/Search Tags: | TRAIL, RT-PCR, Plasmid, Bladder transitional cell cancer TRAIL, T24, apoptosis, cDDP, nude mice | PDF Full Text Request | Related items |
| |
|