| Immune rejection is the main defeated reason of keratoplasty. The ideal immune inhibition is to destroy T cell exacting chain. Antigen is delivered to T cell after dealed with by antigen presenting cell( APC), and rejection happen. Dendritic cell(DC) was found by American scholar Steinman in 1973 .It is known as the best powerful APC. Its role is as 10-100 times as macrophage(MΦ) and B cell's. DC is the beginner of immune reaction and has important role. Some scholars found in skin and spleen transplant that the transplanted organ could live longer if DC be removed.In this study anti-DC monoclonal antibody (DC-mcAb) was used to inhibit DC, and it's effect on keratoplasty rejection is observed.PART ISlitlamp microscope observation of the effect of anti-DC moloclonal antibody on rat keratoplasty rejectionPurpose To use anti-dendritic cell monoclonal antibody (DC-McAb) to inhibit DC, and observe it's effect on keratoplasty rejection using slitlamp microscope. Methods Use 25 Wistar rats as donors, 50 SD rats as receptors. Randomly devided in A,A0,B,C and D group, 10 rats in one grope. Routine PKP was made in group A,A0,B,C. The receptor's epithelium was reserved in group D. Medcine were given 3 days before surgery, surgery day and 1,2,3,5,7,9,11d after surgery. A: sterilized saline 0.5ml, abdominal cavity injection. A0:mouse anti-rat IgG0.1ml+saline0.4ml, abdominal cavity injection. B,D: DC-McAb 0.1ml+saline0.4ml, abdominal cavity injection. C: DC-McAb 0.05ml,subconjectiva injection. Rejective reaction was observed using slit lamp. The degree of cornea opacity,edema,neovascular was as rejective indicator(RI). When RI>6, rejection occurred. Record the days after surgery. Results The rejective reaction occurred at (7.63±0.74) d after PKP in A group,A0 (7.50±0.54) d,compared with A,p>0.05; B (17.11±1.17) d, C (13.86±0.69) d, D (17.88±0.84) d, compared with A, p<0.001; C comparing with B, D,p<0.001; Bcomparing with D,p>0.05oConclusion l.DC-McAb can inhibit the rejective reaction of keratoplasty andelongate cornea lifetime.2.The effect of abdominal cavity injection is better than thatof subconjective injection. 3.The effect of reserveing epithelium or not has nodeference.PARTIIThe pathological observation of the effect of anti-DC moloclonal antibody on ratkeratoplasty rejectionPurpose To study the expression of perforin (PFP) and granzyme B (GrB) in the transplant cornea and the effect of anti-dendritic cell monoclonal antibody (DC-McAb) on the expression.Methods Use 32 Wistar rats as donors, 64 SD rats as receptors. Randomly devided inA,B,C and D group, 16 rats in one grope. The methods of surgery and medicine aresame as part I .4 corneas were excised at 3% 7> 14> 21d after surgery in every group.HE and S-P immunohistochemistry staining of PFP and GrB were performed.Observed using microcscope, The staining degree was indicatored by gray.Results Edema was seen in the cornea, and the cornea had many lymphocytic celK neutrophilic granulocyteN mononuclear cell in stroma. Neovascular grew. The cornea structure was destroyed. Then fibre cell incame, and cornea cicatrized. Marked inflammatory reaction surrounding the sutures was seen characterized by foreign body giant cells,macrophages, and lymphocytes.Compared with A group, cell infiltration, edema and neovascular occurred slowly, and degree was smaller in B> C> D group.The staining of PFP and GrB is brown. PFP and GrB were seen in the plasm of lymphocytic celK neutrophilic granulocyte^ mononuclear cell and cell membrane of cornea epithelium. There is no expression of PFP and GrB in normal cornea. The expression is little at 3d, lot at 7d, peak at 14d, descending at 2Id. The expression of PFP and GrB in B,C,D group is less than that in A. There is relation between PFP and GrB.Conclusion The expression of PFP and GrB colud be seen in cornea afterkeratoplasty. PFP and GrB Participated in rejective reaction. Their expression level was parallel with the rejective degree. DC-McAb could reduce the expression, decrease the rejective degree. There is relation between the expression of PFP and GrB. They were supplementary to each other.PART IIIThe effect of anti-DC moloclonal antibody on the expression of IFN-y mRNA inthe cornea after keratoplastyPurpose To observe the effect of anti-dendritic cell monoclonal antibody(DC-McAb) on the expression of IFNy mRNA in the rat cornea after keratoplasty, and test the effect of DC-McAb on the rejective reaction on the gene level. Methods Use Wistar rat as donor, SD rat as receptor. Randomly devided in A,B group,2 rats in one grope. The methods of surgery and medicine are same as partI .The corneas were excised at 7d after surgery, IFNy mRNA was detected by RT-PCR . IFN-y primer sequence : 5'CCCTCTCTGGCTGTTACTGC3' , 5'CTCCTTTTCCGCTTCCTTAG3', 419bp. 30 cycles(94°C, 1 minite; 65°C, 1 minite; 72°C, 1 minite); 72°C 5 minites.Results The high expression of IFNy mRNA in the rat cornea at 7d after keratolasty could be seen in A group. There is little or no expression in B group. Conclusion The expression of IFNy mRNA could be seen in the cornea after keratoplasty, IFNy has important role in rejective reaction and can be as the indicator of rejection. DC-McAb could decrease the expression of IFNy mRNA.PART IVThe effect of anti-DC moloclonal antibody on the level of IL-2 in the serum after keratoplastyPurpose To detect the density of IL-2 in the serum before and after rat keratoplasty and the densitive change after treated by DC-McAb. Methods Serum was acquired at 3 > 7> 14, 21 d after surgery in A,B,C,D group in the... |