Font Size: a A A

The Abnormal Expression Of ABH And Lewis Blood Group Antigens, Clinical Significance And The Related Mechanisms In Primary Lung Cancers

Posted on:2006-04-25Degree:DoctorType:Dissertation
Country:ChinaCandidate:J LiFull Text:PDF
GTID:1104360152996656Subject:Surgery
Abstract/Summary:
IntroductionBlood group antigens (BGA) are major allogeneic antigens in human. ABO (including A,B,H antigens) and Lewis(including Lea,Leb,Lex,Ley antigens) systems are two most important blood group systems in human. antigen determinants of ABH and Lewis blood groups are carried by two major glycochains, structure I [containing Gal(β1→3)GlcNA C - ] and Ⅱ [containing Gal (β1→ 4)GlcNA C - ] , which combined with glycoprotein in the glycochains. . A,B,H and Lewis blood group antigens are not the genetic products of A,B,Se(FUT2) and Le (FUT3). they are the oligosaccharides molecules of A, B, H and Lewis related blood group antigens, formed through the action of glycosyltransferase from direct products of A,B,Se(FUT2) and Le(FUT3) , the corresponding glucose transportation to the glucose chain. ABH and Lewis blood antigens exist not only on the membrane of red cell, but in epithelium, gland epithelium and the secreta. Investigations revealed that epithelial histo - blood group antigens of ectoderm and endoderm appears earlier than that of mesodermal hematopoietic tissue, therefore the peripheral BGA is also called histo - blood group antigens (HBGA). Recent studies showed that blood group substance is carbohydrate antigen with glycoprotein, whose physiological functions were served as the passage for receptors, signal transduction factors and ions on cell surface. However, some of the physiological role of blood group antigens remains unclear. Due to its carbohydrate with glycoprotein on cell surface, some scientists believed that it might play important roles in the recognition and mobilization of normal and abnormal cells.Since the variation of blood group substance was found in cancer cell in 1957 by Kay et al, plenty of reports were focused on the changes of blood group substance in breast cancer, colon cancer and endometrial cancer. Furthermore, the abnormal expression of blood group antigens was associated with the degree of malignancy, metastasis and prognosis. With the malignant transformation and dedifferentiation, BGA as the subunits of highly differentiated cell structure and physiological function, may present with corresponding pathological changes. Investigators conducted profound research in this field, and probed HBGA in molecular genetics and molecular pathology. Eminent progress has been made in its molecular occurrence. Since the distribution of HBGA is polymorphism, the abnormal expression in tumor is different, especially for Lewis antigens in different tumors. Therefore, the abnormal expression of HBGA in different tumors may be different. Current study on its occurrence remains controversial. And to explore mechanism of abnormal expression of its ralated blood group antigen, the samples were tested for expression of enzyme of A and B mRNA and for methyat-ion of promoter region in ABO gene.Materials143 samples (including 49 frigorific samples) during February 1998 to A-pril 2003 were collected in the Department of Thoracic Surgery, The First Affiliated Clinic Hospital of China Medical University. There were 47 male, 96 female patients with a median age of 52. 8 ( 26 75 ). The compose of blood group of these patients were type A 51, type B 36, type AB 20, type 0 36 respectively. The samples included 143 primarily carcinomas and 41 metastasis lymph nodes. 30 mineral wax samples of normal lung tissues were also chosen. Their compose of blood group were type A 7, type B 7, type AB 6, type 0 10 respectively.Methods1,Immunohistochemistry (IHC)IHC tests were performed by streptavidin peroxidase ( S - P) method. Mouse monoclonal anti -human A,B,H antibodies (1:30 dilution, IgM) , Lea (1:200 dilution) , Leb,sialylLewisx, Ley antibodies (1:00 dilution) ,condense sheep anti - mouse IgM -HRP antibody (1:200 dilution) and the kit of Vltra-Sensitive TMS - P( Streptavidin - peroxidase) IHC purchased from Newmark corporation. The experiments were performed according to the directions. The negative contrast was PBS. The expression was determined according to brown grains in the cytomembrane or cytoplasm. Internal positive contrast was determined according to the expression of blood vessel endothelium and erythrocyte in each slice, the negative contrast was determined according to lymphocyte and connective tissue. 10 fields of vision were chosen randomly in each slice, 100 cell were counted. Negative was determined according to the number of positive cells <5% , positive was determined according to the number of positive cell > 5%.2,Immunofluorescence (IF)Chosen randomly 20 samples embedded in OCT. Frozen sections were cut at 5 |xm at -20℃. Sections were fixed with paraffin for 1 h. then were treated with 0. 2% triton X - 100 for 15 min, and then were blocked with bovine serum albumin (BSA) for 1 h. The samples were incubated with monoclonal antibody for a night at 4 C. After washing with PBS, the samples were incubated away from light with sheep anti - mouse FITC - IgM ( or IgG ) for 1h at room temperature. Then karyotin was performed. The sections were blocked after washing.3,Reverse transcription amplification reaction (RT - PCR)(1) Extraction of total RNA : Total RNA from each sample ( contain 100mg tissue) were isolated by using Trizol solution. The means of extraction of total RNA referred to 《Molecular Coloning》 (the second edition). Then it was conserved at - 70℃. The value of 260/280 was detected with ultraviolet spec-trophotometer, and then calculated the concentration of total RNA.(2) The synthesis of reverse transcription cDNA: The reaction system was 20μl. The condition of reaction was in accordance with the instruction of TaKa-Ra RNA PCR Kit(AMV) Ver.3.0 (TaKaRa CO.)(3) PCR:The primer sequence of A gene was5 - GCCCCAGAAGTCTAATGCCAG -3' (upstream), 5 - CCCCCCCAGGTAGTAGAAATCGCCCTCGTCCTT - 3' ( downstream ). The 25μl solution contained 5 x RNA PCR buffer5μl, Taq DNA Polymerase(5U/L)0. 25μ, cDNA 5μl, ddH2O13. 75μl, upstream primer and downstream primer 0.5μl. respectively. Followed by condition: 94℃ 5min; 94℃ 1min, 56℃ 30sec, 72℃ 90sec and 35 cycles.The primer sequence of B gene was: ( upstream) 5' - TGTTTGGT-TACGGGGTCCTA - 3', 5' - AGCTTCAGGAAAGCCACGTA - 3' (downstream). The 25μl solution contained 5 × RNA PCR buffer5μl,Taq DNA Poly-merase(5U/L) 0. 2μ,cDNA 5μl,dd H2O14μl, upstream primer and downstream primer 0. 4μl respectively. Followed by condition: 94℃ 2min; 94℃ lmin, 57℃ 30sec, 72℃ lmin, 30 cycles and annealed at 72℃ for7min.The primer sequence of Se ( FUT2 ) gene was 5' - CTAGCGAAGAT-TCAAGCCATGTGG - 3' (upstream) , 5' - GACGTACTCCCCCGGGATGTG -3' ( downstream ). The 25 μl solution contained 5 × RNA PCR buffer5 μl , Taq DNA Polymerase(5U/L)0. 2μ,cDNA 5μl ,dd H2O14.30μl, upstream primer and downstream primer 0. 25μl respectively. Followed by condition: 94℃ 2min; 94℃ lmin, 58℃ 30sec, 72℃ lmin, 30 cycles and annealed at 72℃ for7min.The efficiency was detected by β - actin. PCR producteds were resolved on a 2% agarose gel and the bands were visualized by ethidium bromide(EB) staining, then ascertained with 100bp gradient Markers ( TaKaRa co. ).4 Methylation Status detection(1) DNA samples: The DNA samples of tissues were extracted according to 《Molecular Cloning》(the second edition). They were digested in proteinase K lysis buffer, and extracted by Phenol/Chloroform as routine. The purity of DNA should be between 1. 7 and 1. 8. The DNA samples were stored in -20℃ refrigerator for using later.(2) Methylation - specific polymerase chain reaction (MSP) : Methylation Status detection of ABO gene promoter region. The primer for methylation was 5'- TTAAGGTATTAGGGTTACGAGGGGC - 3 ' ( upstream ), 5 ' - CGACCATA-ACTCCGCGTCT - 3 ' ( downstream ) . The 20μl solution contained 10 × PCRbuffer2μl,Taq DNA Polymerase (5U/L) 0. 2μ, DNA 3μl, dd H2 08. 8μl, dNTP2μl, upstream primer and downstream primer 2μl respectively. Followed by condition: 95℃ 9min; 94℃ 1min, 67℃ 1min, 72℃ 2min ,38 cycles and annealed at 72℃ for10min. The primer of unmethylation was 5 ' - GGAT-AGGGTTTTAAGGTATTAGGGTTATG - 3' ( upstream) 5'- CCACATCTAATCT-CAACCTCCA -3'(downstream). The 20μl solution contained 10 × PCR buff-er2μl,Taq DNA Polymerase(5U/L)0. 2μ,DNA 3μl ,dd H2O8. 8μl,dNTP2μl, upstream primer and downstream primer 2μl respectively. Followed by condition: 95℃ 9min; 94℃ lmin, 60℃ lmin, 72℃ 2min ,38 cycles and annealed at 72℃ for10min. 8ul PCR products were subsequently electrophoresed in 2% agarose gel and were analyzed in Chemi Imager 5500 auto - imaging system.Results1,The massculine expression of ABH blood group antigens mostly located in cytomembrane. There was the loss expression of ABH blood group antigens in primarily lung carcinoma. The ratio of massculine expression of A, B, AB, O blood groups were 52. 94% (25/51), 55.6% (0/36), 35.00% (7/20) respectively in lung carcinoma tissues. The expression of H precursor molecule was significant stronger in the group of loss expression of A and B antigens than that of expression (64. 15% vs 11. 11% , P < 0. 001, x2 = 32. 146). There were three in compatible antigens in all lung carcinoma tissues.2,The expression of Lea, Leb located in cytomembrane and cytoplasm simultaneous. The expression Ley and sLex antigens mostly located in cytomembrane. The ratio of expression of Lea and sialyl - Lewisx was higher in lung carcinoma tissues than that in normal lung tissues( P = 0. 045, x2 = 4. 019; P = 0. 015, x2 = 5.923 respectively).3,There was a significant positive dependability between the loss expression of ABH antigens and pathological staging. The ratio of loss expression was higher in progression lung carcinomas than that in the early stage (P =0. 021, x2 = 7.717, r= 0.375). There was a significant positive dependability between the expression of sLex and pathological staging. The ratio of expression was higher inprogression lung carcinomas than that in the early stage (P <0. 001, x2 =15. 335).4,There was a significant positive dependability between the loss expression of ABH antigens and differentiation. The ratio of loss expression was higher in poorly differentiated than that in moderately and well differentiated ( P <0.001, x2 = 16. 286, r =0. 636). There was a significant positive dependability between the expression of sialylLewisx antigen and carcinohistological differentiation. The ratio of loss expression was higher in poorly differentiated than that in moderately and well differentiated (P<0.001, x2 = 16. 510).5, The ratio of loss expression of ABH blood group antigens was higher in non - metastasis group than that in metastasis group ( P = 0. 004, x2 =11.028, r = 0.048 ). The ratio of loss expression of ABH blood group antigens was higher in metastasises than that in primarily carcinomas (P <0. 001, x2 =15. 112). The ratio of expression of sLex antigen was higher in non - metastasis group than that in metastasis group. The ratio of expression of sialyl - Lewisx antigen was higher in metastatic than that in primarily carcinomas (P<0.001, x2 = 18. 489).6,The ratio of expression of A, B and FUT2 mRNA are significant higher in normal lung tissue by carcinomas' side than that of carcinomas tissue. The down - regulation of glycosyltransferase is uniformity with the absence of ABH antigens.7,The ratio of methylation of ABO gene promoter region was higher in carcinomas tissue than that of the normal lung tissue by carcinomas' side. (x2 = 7. 813 ,P =0.005). It is higher in the group of ABO mRNA loss expression than that of expression( x2 = 11.055 , P = 0. 001) . The loss expression of ABO blood group antigens is uniformity with the methylation of ABO gene promoter region. The ratio of loss expression of A and B antigens is higher than the methylation of ABO gene(x2=6.241,P=0.012).Conclusions1,There are the loss of ABH antigens and the strong expression of Lewis...
Keywords/Search Tags:Histo - blood group antigen, ABH, Lewis, Lung, Lung neoplasms
Related items