Font Size: a A A

The Correlation Study Of PKC-α And MDR In Kidney Cancer

Posted on:2006-02-08Degree:DoctorType:Dissertation
Country:ChinaCandidate:L Z LiFull Text:PDF
GTID:1104360152996655Subject:Surgery
Abstract/Summary:
ObjectiveProtein Kinase C is one of the earliest established Protein Kinase, made up of serine/threonine protien kinase family, whose construction close to each other , on which calcfium and phosphatide rely, activated by diacylglycerol (DG). PKC adjust different function of various kinds of cells, including tumor cell, though serine/threonine phosphorylation. PKC has important effect on cellular growth, differerntiate and such of signal conductions. For the past few years, it is known that participation of PKC in tumorous development and growth is key point factor of tumour cell adhesion, motion,invasion and transfusion.Study on cDNA of isozymes of PKC indicate that the polypeptide chain N -terminal sequence is regulatory domain, and the carboxyl terminal is catalytic domain is exposed. There is a hinge domain which can be hydrolyzed by protease between them. When enzyme were activated, the hinge domain is degradat-ed so thar PKC active site. The difference between pseudosubstrate site in regulatory domain and true substrate is that alanina in phosphorylation site displace serine/threonine residue, and close enzyme activation center instead of phosphorylation.PKC usually reside with inactivestyle in endochylema under quiescent condition. With surrounding stimulation, PKC is activated because of translation to cell membrane. Temporal PKC activation seems important effect in short - term events, ( such as ion inflow, secrete, and so on) , which induced in signal conduction access. Persistent PKC activation seems consequence effect in cell multiplication , differentiate, tumorigenesis and so on. PKC is tumor promoter phor-bol 12 - myristate - 13 - acetate intracellular receptor. Its over - expression in-duces cell growth disorder and triggers tumorous form.Efferth et al. investigate PKC express in 18 kinds of human renal cell carcinoma system with immmuocytochemistry. There are intimate correlations between PKC high express and drug resistances of cancer cell for Adriamycin and P glucoprotein. PKC participate renal cell carcinoma endogenous drug resistances though PKC phosphorylation.PKC generally exist in animal, microbeorganism, and present in overall tissue and organ. There are four categories and thirteen subtypes in PKC based on different grades in isozyme construction, enzymic character, activating agent. Classical PKC (cPKC) : α,βⅠ,βⅡ,γ, which are activated by calcium , phosphatide, diacyglycerol (DAG) or phorbol ester. Novel PKC ( nPKC ) : (?) η,δ,ε,θ, which are activated by phosphatide, diacyglycerol( DAG) or phorbol ester instead of calcium. Atypical PKC (aPKC) : T/λ,ξ , which are only activated by phospholipin. Recently a kind of PKC is found , which is activated by phosphatidylinositol -4,5- diphosphate instead of calcium and DAG and is similar to the others in construction. So this kind of PKC is called the fourth kind of PKC. Various kinds of isozyme have different specificity of distribution and effects.We use research in vitro to discuss mechanism of MDR in renal cell carcinoma at the PKC subtype level, to provide the experiments about treating renal cell carcinoma.The experiment divides three parts:One; LR\BR recombination reactions were used to generate mammalian expression vectors of protein kinase C alpha cDNA with C - terminal fused GFP, and vectors were transfected into human RCC cell with Lipofectimine 2000. Western Blot and Inverted Fluorescent Microscope were used to determine the expression of PKC - a gene in RCC cells transferred by PKC - α cDNA.Two: LR\BR recombination reactions were used to generate mammalian expression vectors of protein kinase C alpha cDNA with C - terminal fused GFP, and vectors were transfected into human RCC cell with Iipofectimine 2000. Western Blot ,and Inverted Fluorescent Microscope were used to determine the expression of PKC - a in RCC cells transferred by PKC - α cDNA; RT - PCRwere used to determine the expression of MDR related gene in RCC cells transferred by PKC - αcDNA .Three: To investigated the expression of PKC - a in membrane and plasma of 30 cases renal cell carcinoma and normal adjacent tissue by Western blotting technology.MethodsCells culture786 - 0, was maintained in RPMI - 1640 medium, supplemented with 10% fetal bovine serum (FBS) , 2mM glutamine, 25mM HEPES at 37oC in a humidified, 5% CO2incubator.Plasmid constructThe PKC - α cDNA was subcloned into pDONRTM201 donor vector by PCR with Pyrobest DNA Polymerase using BP Clonase Reaction system. Entry clone was identified by DNA sequencing analysis. pcDNA - PKC - α - GFP recombi-nant plasmid expressing PKC - α with C - terminal fused Green Fluorescent Protein (GFP) was constructed with entry clone and GFP expression vector pcDNA - DEST47 using Gateway LR recombination reaction system. primers were designed as follows: 5 ' - ATG GCT GAC GTT TTC CCG GGC AA - 3 ' ;5 ' -CAT ACT GCA CTC TGT AAG ATG GGG -3'.Cell transfectionThe cells were transfected with pcDNA - PKC - α - GFP vector by Lipofec-timine2000 reagent. Positive clones were identified by GFP fluorescence microscopy.Selection of stable expressionThe stable expression clones (786 - 0/PKC - α - GFP) were established by the selection with G418 at a concentration of 400 μg/ml for four weeks. clone Isolated clones were analyzed for PKC - α - GFP expression by western blot analysis and fluorescence microscopy.Multidrug resistance correlated genes assaysTo identify the alteration of Multidrug resistance correlated genes, MDR1, MRP1, LRP gene were assayed using RT - PCR , primers were designed as follows: MDR1:5' -ACACCCGACTTACAGATGATGTCTC-3' , 5' -CGAGAT-GGGTAACTGAAGTGAACAT - 3 ' , length of fragment:623bp; MRP1: 5 ' -AGTGACCTCTGGTCCTTAAACAAGG - 3 ' , 5 ' - GAGGTAGAGAGCAAG-GATGACTTGC - 3 ' , length of fragment:657bp; LRP: 5 ' - GAGCAGTTCA-CAGTGTTGTCC - 3 ' , 5 ' - GCGTGACGACAGAAACCGAAA - 3 ' ; length of fragment: 342bp.Expression and significance of PKC - a in renal cell carcinoma and normal adjacent tissueTo investigated the expression of PKC - a in membrane and plasma of 30 cases renal cell carcinoma and normal adjacent tissue by Western blotting technology.ResultsPKC - α cDNA was identified by DNA sequencing analysis.To investigate the effect of PKC - α on the drug resistance of renal cell carcinoma cells, we established stable cell clones expressing PKC - α - GFP using 786 -0 drug - sensitive RCC cell line. Three highest expression clones were i-dentified by western blot analysis. In order to further identify the character of expressed PKC - α - GFP, fluorescence microscopy was conducted to examine the distribution of PKC - a - GFP. As the result, these data demonstrated that stably expressed PKC - a - GFP has the same character as endogenous PKC -a.Effect of PKC - a on the drug resistance of 786 - 0MDR1,MRP1, LRP genes were detected in 786 - 0/PKC - α - GFP cells, and , for comparison, 786 - 0 cells. While 786 - 0 cells expressed MDR1, MRP1 and LRP were detected by RT - PCR , MDR1 expression in transfected 786 - 0 cells was significantly higher than that in homologous cells. Nevertheless for MRP1 and LRP, the diversification of expression were indistinguishable be-...
Keywords/Search Tags:gene, protein kinase C (PKC), transfection, multidrug resistance (MDR) renal cell carcinoma (RCC), PKC - α, Membrane, Plasma
Related items