| ObjectiveNeutralizing antibodies ( NAbs) have been considered as an important component of a protective immune response as indicated by studies involving long -term nonprogressors ( LTNPs) , HIV - 1 neutralizing antibodies are directed a-gainst linear or discontinuous epitopes of the gpl20/gp41 envelope glycoprotein. In HIV - 1 - infected humans, the most broadly neutralizing antibodies are directed against the CD4 - binding site ( CD4BS) and block gpl20 - CD4 binding. For vaccine - mediated protection, high levels of neutralizing antibodies appear to contribute to protection against HIV - 1. Unfortunately, with the disease progression, the viral inhibitory activity of neutralizing antibody was replaced by the appearance of resistant virus. The studies demonstrate that amino acids alterations within epitopes of neutralizing antibodies can result in conformational variation and viruses resistant to neutralization. In HIV - 1 - infected individuals, different races exist diversity on immunity and heredity. Most of present studies are based on occidental. What about neutralization and amino acid mutations within epitopes in Chinese HIV - infected individuals and AIDS patients? There has been no such investigation reported in China. We studied neutralizing antibody levels and amino acid mutations of conserved neutralization epitopes of HIV - 1 in HIV - infected individuals, long - term nonprogressors and AIDS patients in China. Hopefully this will provide a basis for the design of vaccines and antibody immunotherapy.Material and Methods1. Study populationDiagnosis of HIV -1 infection was made on the basis of a positive anti -HIV ELISA (Vironostika, Organon Tednika, The Netherlands) and confirmed by a positive Western immunoblot (Genelab Diagnostics, Singapore ). Treatment - naive subjects were asked to participate in the study.2. Single - Round PBMC neutralization assayNeutralization assays were performed in 96 - well culture plates by incubating virus stock with diluted plasma specimen, heat - inactivated at 56°C for 30 min. Approximately 20000TCID50 ( determined by Spearman - Karber equation assay) of HIV -1 was added to each well. After incubation for 30 min at 37Xi, PBMC(3.0 xlO5 cells) was added to each well. PBMC were maintained in IL - 2 culture medium containing 1 |xM indinavir, and the cells were fed in IL - 2 culture medium on day 1. PBMC were harvested for Cell surface CD3 and CD4 staining on day 2. To enumerate infected CD4+ T lymphacyte, cells were washed, fixed and permeabilized, and stained with the KC57 anti - p24 antibod-y. For each plasma dilution, cells were measured by flow cytometry. At least 50000 events were counted. The percent neutralization was defined as reduction in the number of p24 - Ag - positive cells compared with the number in control wells with no antibody. The neutralization titer was that which resulted in a 50% decrease in the number of infected CD4 + T cells compared to the number of infected CD4+ T cells in control wells with no antibody. Antibody dose response curves were fit with a nonlinear function, and the neutralization titer was calculated by a least - squares regression analysis.3. HIV - 1 RNA extractionQIAamp Viral RNA Mini Kit was used to extract HIV - 1 RNA from plasma of peripheral blood.4. RT-PCR and nest-PCRThe outer primers were env - B (5'- ATGGGATCAAAGCCTAAAGCCAT-GTGT- 3') andenv-K(5'- GCGCCCATAGTGCTTCCTGCTGCTCC - 3')-The inner primers ED31(5'- CCTCAGCCATTACACAGGCCTGTCCAAAG - 3 0 andED33(5'- TTACAGTAGAAAAATTCCCCTC - 30 were used for amplifying 500bp gene segment in gpl20 env C2 ~ C3 region;The inner primers E7 (5'- CTGTTAAATGGCAGTCTAGC - 3') and E8 (5'- CACTTCTCCAATT-gTCCCTCA - 30 were used for amplifying 700bp gene segment in gpl20 env C3 ~ C4 region.5. Nucleic acids sequence detectionThe nest - PCR amplified product was used as template, ED31 and E8 as primer, BigDye Terminator Mixes as substrate. ABI PRISM 377 -96 Sequencer was used to detect nucleic acids sequence.6. Amino acids sequence analysisBio - edit software was used to deal with the primary nucleic acids sequence. After revising nucleic acids sequence according to chromatogram, translate genes sequence into amino acids sequence, and compare with neutralization epitopes reference data ( HXBc2) in HIV -1 Sequence Database.Results1. Comparison of neutralizing antibody levels among HIV - infected individuals, AIDS patients and LTNPs.The geometric mean titers for HIV - infected individuals, AIDS patients and LTNPs were respectively 1:29.09, 1:22.07 and 1:154. 37. The neutralization titers of LTNPs were significantly higher than that for HIV - infected individuals (t= -2.220, P<0.05) and AIDS patients(t= -3.812, P<0.01). The neutralization titers showed no significant difference ( P > 0. 05 ) between HIV - infected individuals and AIDS patients.2. Mutations in conserved neutralization epitopes identified in HIV gpl20 C2 ~ C3 regions of HIV - infected individuals, AIDS patients and LTNPsFor HIV - infected individuals and AIDS individuals, conserved epitopesfor neutralizing antibodies CD4BS, CD4i and 2G12 identified in HIV gpl20 C2~ C3 regions existed amino acid changes. For HIV - infected individuals, themutation rates of CD4BS, CD4i and 2G12 epitopes were respectively 19. 5% N17.1% N36.6% . For AIDS patients,the mutation rates of CD4BS^CD4iN2G12 epitopes were respectively 16. 0% ^16. 0% N32. 0%. Whereas LTNPs existed 2G12 epitopes mutation only ,which mutation rates was 25.0%. The mutation rates of conserved neutralization epitopes had no significant differences ( P > 0. 05) among HIV - infected individuals, AIDS and LTNP groups.3. The constituent ratios for mutant conserved neutralization epitopes in HIV gpl20 C2 ~ C3 region.The constituent ratios for mutant conserved epitopes of neutralizing antibodies CD4BS, CD4i and 2G12 were 25. 0% , 22. 9% and 52. 1% respectively. Chi -square test, P =0. 003. There were significant differences among them. The constituent ratio for 2G12 epitope was much higher than CD4BS and CD4i epitopes.4. Mutations in conserved neutralization epitopes identified in HIV gpl20 C3 ~ C4 regions of HIV - infected individuals, AIDS patients and LTNPsFor HIV - infected individuals and AIDS individuals, conserved epitopes for neutralizing antibodies CD4BS, CD4i and 2G12 identified in HIV gpl20 C3 ~ C4 regions existed amino acid changes. For HIV - infected individuals, the mutation rates of CD4BS, CD4i and 2G12 epitopes were respectively 12. 5% , 25.0% and 31.3%. For AIDS patients, the mutation rates of CD4BS,CD4i, 2G12 epitopes were respectively 7. 1% , 14. 3% and 21. 4% . Whereas LTNPs existed 2G12 epitopes mutation only, which mutation rates was 25. 0%. The mutation rates of conserved neutralization epitopes had no significant differences ( P > 0.05) among HIV - infected, AIDS and LTNP groups.5. The constituent ratios for mutant conserved neutralization epitopes in HIV gpl20 C3 ~ C4 region.The constituent ratios for mutant conserved epitopes of neutralizing antibodies CD4BS, CD4i and 2G12 were 15. 8% ,31.6% and 52.6% respectively. Chi -square test, P =0. 05. There were significant differences among them. The constituent ratio for 2G12 epitope was higher than CD4BS and CD4i epitopes.
|
PDF Full Text Request