Combined Detection Of CD44v6 And Nm23H1 Protein And MRNA Expression In Non-small Cell Lung Cancer | | Posted on:2005-10-21 | Degree:Doctor | Type:Dissertation | | Country:China | Candidate:B Liu | Full Text:PDF | | GTID:1104360152496648 | Subject:Surgery | | Abstract/Summary: | | | Lung cancer remains the most common cause of death in both men and women. Moreover, the death rate for lung cancer increased steadily by years. Non-small cell lung cancer ( NSCLC) accounts for 70% 80% of all lung cancers. Metastases are more common in lung cancer. About one third of NSCLC has distant metastases at the time of diagnosis and is not suitable for surgical resection. To the remaining two thirds, regional lymph node metastases have been the main predictor of poor prognosis. Thus, understanding the molecular mechanism of metastases is needed to improve our therapeutic approaches. Recently, many studies have searched factors to predict the outcome of NSCLC, in order to improve the clinical approaches. Some reports linked the high expression of CD44 or low expression of nm23 to tumor progression while others did not. These reports studied the two separately and the results were unsatisfactory.Our present study includes three parts, which aim to: 1. Combined detection of CD44v6 and nm23H1 protein was evaluated as the marker of metastases and prognosis. 2. Combined detection of CD44v6 and nm23H1 mRNA in tissues was associated to the local lymph node status. 3. Combined detection of CD44v6 and nm23H1 mRNA in blood and comparison of the results with that of the tissues were examined as scatheless measure before operation.Materials and method1. Main apparatus: Gene PCR Ampthermocycler ( Biometra, Germany) , NV-VIS Spectrophotometer (Shimadzu, Japan) , Centrifuge (FISHER) , General electrophoresis system (GIBCOBRL).Main reagents: Monoclonal antibodies of CD44v6 ( MAB-0066) andnm23H1 (MAB-0139), S-P kits ( Kit-9701) , Total RNA extractor, RT-PCR kits.2. Specimen preparation31 fresh specimens, pathologically identified as NSCLC, were taken for RT-PCR test from Department of Thoracic Surgery, General Hospital of Shenyang Military Region, between Jun 2002 and Jun 2003. Grade I (T1-2N0) 11 cases, Grade Ⅱ (T1-2N1 and T3N0) 15 cases and Grade IIIa (T3N1 and N2) 5 cases. Squamous cell carcinomas 16 cases, adenocarcinomas 13 cases and adeno-squamous carcinomas 2 cases. 19 cases had pathological identification of local lymph node metastases while 12 did not. 10 cases of control were taken from lung infections and diffuse interstitial lung diseases. Two milliliter of veinal blood sample was taken before operation, anticoagulated by EDTA, mixed gently with 2ml normal saline, centrifuged with 4ml trizol by 2000 bpm, 20 minutes. The lymphocyte layer was taken and shock-frozen in liquid nitrogen to -70℃. All tumor and control tissue specimens were taken after being surgically removed and were shock-frozen in liquid nitrogen to - 70℃ immediately.108 paraffin-embedded NSCLC specimens were included for immunohisto-chemical test. All cases were collected at the Department of Thoracic Surgery, General Hospital of Shenyang Military Region, between Jun 1998 and Jun 2000. All cases had pathological identification, including 56 squamous cell carcinomas , 44 adenocarcinomas, 5 adenosquamous carcinomas and 3 large-cell carcinomas. 73 cases were with lymph node metastases (N1, N2) and 35 cases were not (N0). The ages of the patients ranged from 32 to 70 years (median 58 years) , and the follow-up time was from 3 to 60 months (mean 40. 8 months).3. Immunohistochemistry test: With S-P method of immunohistochemistry, 4μm sections were made in 108 paraffin-embedded NSCLC specimens. Endogenous peroxide activity was blocked with hydrogen peroxide. Pre-incubated with normal serum, separate sections were then incubated with primary and secondary antibody. Immunostaining was visualized after DAB stain and counterstain with haematoxylin.4. Total RNA extraction and RT-PCRTotal RNA was extracted from isolated lymphocyte or 0.5 cm3 tissue blockby the chloroform isopropanol alcohol method. Two pairs of primers were designed to amplify CD44v6 and nm23Hl cDNA. β-actin, as internal control, was also amplified at the same time.nm23H1 primer (685bp) :F5'ATGGCCAACTGTCATTCATAG 3'R5'GCCCTCCTGTCATTCATAG 3'CD44v6 primer (720bp) :F5'CAGACCTGCCCAATGCCTTTGATGGACC 3'R5'CAAAGCCAAGGCCAAGAGGGATGCC 3'β-actin primer (690bp) :F5'GATTGCCTCAGGACATTT 3'R5'GATTGCTCAGGACATTTCTG 3'The product was observed by electrophoresis on agarose gel and the expression level of genes was determined according to intensity of PCR product.5. Statistical analyses were performed using SPSS v11.5 for Windows XP. Chi-square test was performed for analyses of categorical data, ANOVA for numeric data and Kaplan-Meier for survival.Results1. Tissue group with local lymph node metastases had a significantly higher CD44v6 mRNA expression than group without local lymph node metastases ( p < 0.01). Expression of nm23H1 mRNA was significantly lower in tissue group with local lymph node metastases than in group without local lymph node metastases (p <0. 01).2. Blood group with local lymph node metastases had a significantly higher CD44v6 mRNA expression than group without local lymph node metastases ( p < 0. 01 ). Expression of nm23H1 mRNA was significantly lower in blood group with local lymph node metastases than in group without local lymph node metastases ( p < 0. 01). But the separate factor's specificity and exactness was not good when used in diagnostic test for local lymph node metastases.3 Among the 12 cases of N0, there were 3 cases which had high CD44v6and low nm23H1 mRNA expression. We re-checked the HE sections of the lymph nodes in four 4μm seriate sections and found one with micrometastases. Therefore, the stage of this case changed from "T1N0M0" to "T1N1M0".4. The separate CD44v6 or nm23H1 factor' s specificity and exactness was not good when used in diagnostic test for local lymph node metastases. But combined detection of them in serial test improved the specificity and exactness.5. High expression rate of CD44v6 protein and low expression rate of nm23H1 protein were 47. 2% and 54. 6% respectively. A positive relationship was shown between CD44v6/nm23H1 protein expression and local lymph node metastasis (p <0.01). Kaplan-Meier analyse showed that CD44v6 or nm23H1 did not correlated with survival time respectively (p >0.05) , but combined detection of them correlated significantly with survival time ( p <0. 01).DiscussionMetastases are more common in lung cancer and become the most important cause to death. It is needed to detect the metastases improve the clinical therapeutic approach. Non-small cell lung cancer ( NSCLC) accounts for 70% 80% of all lung cancers. Metastases are more common in lung cancer. About one third of NSCLC has distant metastases at the time of diagnosis and is not suitable for surgical resection. To the remaining two thirds, regional lymph node metastases have been the main predictor of poor prognosis. For now, methods to detect metastases are limited. Metastases can be found by imaging, but often in middle or late stage. Mediastinoscopy is not easily accepted by patients because of its invasiveness. In an effort to identify those patients who have early lymph node involvement by metastatic disease, several groups of investigators have searched for the presence of micrometastases in hematoxylin-eosin negative lymph nodes using immunohistochemical or molecular methods.Gunthert proved CD44 correlated with tumor metastases in 1991. CD44 has different splicing variants, CD44v6 is one of them. Results on association between CD44v6 expression and metastases differ from each other. Mizera found CD44v6 expression did not correlate with metastases; Tran et al showed a signif-icant correlation of CD44v6expression and lymph node metastases. We studied the expression of CD44v6 from tissue and lymphocyte mRNA to protein and found it correlated significantly with local lymph node metastases of NSCLC. The possible mechanism of CD44v6 to motivate metastases is that tumor cell combined with receptors in blood or lymph serum. These combinations made tumor cell more stable in tissues. But individual detection of CD44v6 as diagnostic test for lymph node metastases showed less specificity and exactness.Steeg et al cloned nm23 gene in melanoma cell strain in 1988. It has been found that human nm23 gene has two subgroup, H1 and H2, which located in chromosome 17q22 coding a 152-aminoacid 17kD protein NDPK. Researches showed that nm23H1 inversely correlated with malignant tumor metastases ability. Therefore it was called non-metastases gene. Lai et al considered the expression of nm23H1 inhibited local lymph node metastases of lung cancer. Domestic investigators results showed the more expression of nm23H1, the later in staging, and the more metastases. We studied nm23H1 expression from mRNA to protein and found low expression of nm23H1 correlated with local lymph node metastases of NSCLC, which indicated that nm23H1 played a role in tumor metastases. But individual detection of nm23H1 as diagnostic test for lymph node metastases showed less specificity and exactness.Because of the limit of individual factor, it is not possible to estimate metastases and prognosis with single factor. Since factors interacted each other, it is possible to combine complementary factors to improve the specificity and exactness. We combined metastases-boosting gene CD44v6 and metastases-inhibiting gene nm23H1, in order to estimate the value as predictors of metastases and prognosis. The results showed high expression of CD44v6 and low expression of nm23H1 correlated with lymph node metastases.Our study measured CD44v6 and nm23H1 mRNA in blood lymphocyte before operation. The separate CD44v6 or nm23H1 factor's specificity and exactness was not good when used in diagnostic test for local lymph node metastases. But combined detection of them in serial test improved the specificity and exactness. Moreover, with clinical data, it could indicate metastases before operation to help make reasonable plans. It could also be used in monitoring relapse and... | | Keywords/Search Tags: | CD44v6, nm23H1, NSCLC, metastases, prognosis | | Related items |
| |
|