| It is well known that invasion and metastasis of malignant tumor are the main cause that result in the death of patients. Indifinite tumor growth, invasion and metastasis depend on the forming of blood vessel and degradating of extracellular matrix (ECM). Neovascularization, when uncontrolled, not only provide the nutrition or oxygen that tumor needs, remove metabolite but also result in the distant metastasis. This complex processes can be elucidated as follows: First, tumor cells bind to the integrin or non-integrin receptor on the surface of matrix, then disrupts the ECM and penetrates the basement membrane(BM) into lymphatics and blood vessels. At last tumor was implanted in distant organ. Matrix metalloproteinase (MMPs) are a family of matrix-degrading enzymes, which collectively are capable of degrading a wide variety of ECM and BM proteins while MMPs-the most important member, is secreted as inactive zymogens(proMMP) and can be activated by a multimeric receptor/activation complex consisting of the membrane type 1 MMP (MT1-MMP), the tissue inhibitor of metalloproteinase (TIMPs) and integrin αvβ3. It was postulated that association of MMP-2 with this complex occurs in two ways: first, the activated N-terminal domain of MT1-MMP binds to TIMP2, in turn, associates with the C-terminal of proMMP2 to form MT1MMP-TIMP2-proMMP2 complexes. ProMMP2 also can directly binds to integrin αvβ3 via its C-terminal. Activated MMP2 futher binds to integrin αvβ3, degrades ECM and promotes the angiogenesis, invasion and matastasis of tumor.Recently report studied by Brooks provide evidence that the noncatalytic C-terminal hemopexin-like domain of MMP2, PEX, can interact with integrin αvβ3 and thereby block MMP2 binding to this integrin and inhibit the degrating of ECM and suppress angiogenesis. The anti-angiogenesis effect of PEX may provide a potential novel therapeutic approach for diseases assciated with neovascularization.To analyze the effect of PEX on angiogenic process in vivo, C-terminal fragment of murine MMP-2 (PEX) was isolated by using RT-PCR. To ensure secretion of PEX by the target cells, the signal peptide sequences of 87bp MMP2 were included in the upstream of PEX cDNA, then the expression vector pcDNA3.1-sig-PEX was constructed, the anti-tumor effect in vitro and in vivo was observed and its biological effects were studied . 1. Construction and identification of pcDNA3.1-sig-PEXTwo pairs of primers of PEX were designed and synthesized according to the published sequence. Signal primer: Sig-F: 5'- GCTAGCATGGAGGCACGAGTGGC CTG-3' ；Sig-R: 5'-ACAATGTCCTGTTTGCAGATAGCGATGGCGCGGCCCA AC A-3.PEX primer: PEX-F:5'-ATCTGCAAACAGGACATTGT-3';PEX-R:5'- TCGAG GCAGCCCAGCCAGTCTGATT -3'. The Sig and PEX cDNA sequence were amplified respectively from NIH3T3 cells by using RT-PCR, then the Sig/PEX complex were used as template to clone Sig-PEX cDNA sequence with Sig-f/PEX-R primers. The specific cDNA was cloned into the pMD-18T vector. The recombinant plasmid was confirmed by DNA sequencing. Then the recombinant plasmid was digested with NheI and XhoI . The released insert was cloned into eukaryon expression vector pcDNA3.1 named pcDNA3.1-Sig-PEX.Expression of recombinant plasmidPcDNA3.1-Sig-PEX plasmids were packed with liposome to transfect B16F10 cells. Through G418 selection, the B16 cells that could stably express PEX were gained. mRNA expression level was detected by semiquantity RT-PCR and PEX protein expression in supernatant was detected by western blot. These results showed that the transfected exogenous gene could successfully secrete and express in target cells by the leader of signal peptide.3.Studying the role of PEX in B16F10 in vitro3.1 Effect of PEX on B16 proliferationWe plotted the growth curves of BpcDNA-SPEX, BpcDNA and B16 cells. According on the curves the growth and proliferation of B16 cells transfected with PEX gene are not markedly different from those of none-transfected control cells and transfected with vector cells. The result showed that the PEX g... |
PDF Full Text Request