Font Size: a A A

Effects Of Invigorating The Kidney And Resolving Phlegm Chinese Herbs On Nerve-Endocrine-Immunity Network Of Chronic Bronchitis Animal Model

Posted on:2003-11-22Degree:DoctorType:Dissertation
Country:ChinaCandidate:S L WangFull Text:PDF
GTID:1104360065450263Subject:Integrative basis
Abstract/Summary:PDF Full Text Request
ObjectiveThe main objectives of the present study are: 1. Observing the expression of androgen receptor (AR) in trachea and lung of male rat and mouse, so as to look of the material base of "mutual promotion of lung and kidney'\ "The kidney controls and promotes inspiration since lung governs reception of air " in Traditional Chinese Medical (TCM), and to provide evidence for prevention and cure of chronic bronchitis by the use of Therapy for Invigorating the kidney. 2. Observing the change of nerve-endocrine-immunity network on male rat and mouse chronic bronchitis model caused by the breath of cigarette smog, and to investigate the pathogenic mechanism of chronic bronchitis. 3. Observing the effect of Invigorating the Kidney and resolving phlegm Chinese herbs to chronic bronchitis animal model caused by breath of cigarette smog nerve-endocrine-immunity network, and to investigate the mechanism of prevention and cure of chronic bronchitis by the use of Invigorating the Kidney and resolving phlegm Chinese herbs. MethodsExperiment 1: The expression of androgen receptor (AR) mRNA in the trachea and lung health male mouse.Selecting 10 health male mice, anesthetized with ketamine, and then cut out the trachea, lung and testis (all instruments were treated by inactived RNA enzyme), and then put these tissues into liquid nitrogen for freezing conservation immediately. Using one-step method ofisothiocyanate-guadine-phenol-chloroform to extract total RNA, and examining the expression AR mRNA in mice's trachea, lung and testis by the RT-PCR and TaqMan technical real-time fluorescent quantitative detection. The quantity of AR mRNA expression was direct assay by ABI PRISM 7700 Sequence Detection System.The AR Primer alignment is:5' -TTACAGCAGAGGCAGGAGACT-3'5' -TGGGGCAGCTGAGTCATCCT-3'The fluorescence probe alignment is:5' -FAM CCACCCTGAGAGAGCAGCTGCCT DABYCLE-3' Experiment 2: the location study of AR in the trachea and lung of normal male ratSelecting 10 health male Wistar rats, anesthetized with ketamine abdominal cavity injection (3mg/kg) and then opened the thoracic cavity, and poured normal saline into the rat's heart until the colour of lung became white. Cutting out the trachea, lung and testis, and then put them into 4% paraformaldehyde for 24 hrs fixing, finally, put these tissues into 25% sucrose solution for one night, make slice at instant lower temperature, the thickness of the slice is 8 um. Dyeing method is Immunohistochemical method LAB-SA. The positive control is rat's testis tissue sample, are negative control is PBS instead of first antibody. The expression of AR was observed with optics microscope. It is positive expression if brown-yellowish granules were found in cytoplasm or nucleus, HPIA-1000 high clarity colour pathological map analytical system was used to measure mean ash density and mean optical density of positive cells as well as AR amount in the tissues of trachea and lung.Experiment 3: Replicating Method of chronic bronchitis animal model by cigarette smoking60 normal male mice weighted 18-22g were randomly divided into 5 groups, those were normal control (NC) group, chronic bronchitis model(CBM) group, large dose Invigorating the Kidney and resolving phlegm (LDIKRP) group, small dose of Invigorating the Kidney and resolving phlegm (SDIKRP) group and Guilongkechuanning (GLKCN) group. Except for the normal control group, the other 4 groups were treated with cigarette smoke in the smoke box, 2 time every day and 4 each time. After continuous treatment for 30d, the animals were treated 1 time each day for 30d. Except for chronic bronchitis model group, the other 3 groups were medicated by stomach perfusion according to physiological dose from the first day of smoke treatments. After 61 days, the animals were killed.72 normal male wistar rats weighted 180-220g were randomly divided into 6 groups, those were normal control groups, chronic bronchitis model group, large dose of Invigorating the Kidney and resolving phlegm group, small dose of Invigorating t...
Keywords/Search Tags:chronic bronchitis, Invigorating the Kidney and resolving phlegm, male rat and mice, androgen receptor, reproduction endocrine, interleukin, neuropeptide, immunohistochemistry, RT-PCR, histopathology
PDF Full Text Request
Related items
Exposure To Inflammation At Different Life Stages Persistently Impairs Male Reproduction And Endocrine Function In Male Mice
Invigorating The Kidney And Resolving Phlegm Tongjing Decoction In The Treatment Of Kidney Deficiency And Phlegm Stasis Type Adolescent Amenorrhea Clinical Observation
The Clinical Research On The Treatment Of Invigorating The Kidney And Activating Blood And Resolving Phlegm Decoction To Polycystic Ovary Syndrome And Insulin Resistance Patients
Clinical Effectiveness Of Invigorating The Kidney And Resolving Phlegm Treating Polycystic Ovarian Syndrome
Effects Of The Prescription Of Invigorating Kidney And Resolving Phlegm And Removing Blood Stasis On Follicular Development And Testicular Morphology In TX Mice With Wilson Disease
Effects And Mechanisms Of Reproduction Endocrine Function In Male Rats Induced By Microcysitns Exposure
Clinical Study On The Curative Effect Of Relieving Phlegm And Relieving Asthma And Invigorating Spleen And Invigorating Qi In The Treatment Of Asthmatic Bronchitis In Children By Stages And Reducing Wheezing Recurrence
Traditional Chinese Medicine Of Invigorating The Kidney And Resolving Phlegm On The Inhibin B Level In Patients With Polycystic Ovary Syndrome
Correlation Between Endogenous Steroid Hormone Receptor And Liver Histopathology In Peripheral Blood Mononuclear Cells And Liver Tissues Of Patients With Chronic
10 Experimental Research On The Effect Of Enzymology And The Expression Of Nerve Growth Factor On Cerebral Ischemia Of Tonifying The Kidney, Resolving Phlegm, And Invigorating Qi, Promoting Blood Circulation