| Taking genomic DNA of transgenic poplar as template,the sequences between two T-DNAs and flanking T-DNA were cloned.The result showed that both right and left border have lost partial sequence in transgenic poplar with multiple copies of the exogenous gene. Compared to the typical T-DNA border sequence,in the first case,the right border truncates at G and the sequence ACAGGATATATTGGCGGGTAAAC was lost,while the left border truncates at T and the sequence TGGCAGGATATAT was lost.These results suggesting that the two T-DNAs integrate in a head-to-tail manner,a typical integrated manner of T-DNA.In the second case,there was 334bp sequence inserted between two T-DNAs.The inserted fragment came from the T-DNA.There were 19bp(GATATATTGGCGGGTAAAC) and 7bp (TGGCAGG) lost at the right and left border of the T-DNA,respectively.The poplar sequences flanking the T-DNA were rich in A+T,62.07%at left and 72.11%at right.And there were 22bp (CAGGATATATTGGCGGGTAAAC) and 13bp(TGGCAGGATATAT) lost at the right and left border of the T-DNA.A universal method for detection of transgenic poplar,as well as the integration of T-DNA in transgenic poplar,was presented in this study.A rapid,easy and reliable semi-nested PCR method was developed with primers designed according to the sequence of nos terminator on T-DNA.With the primers designed from the sequence T-DNA and the tree DNA flanking T-DNA ,a PCR method was developed to distinguish different lines of transgenic poplar.An experimentwas conducted to study the resistance of transgenic hap loid Xiaohei pop lar(Populus simonii Carr.×P.nigra L.) to tent caterp illars(Malacosoma neustria testacea Motschulsky).Result showed that the transgenic poplar could delay the development of larvae. Compared with the control,the two transgenic lines TT1 and TT3 retarded the development of the 1-3 instar larvae for 1.24 days and 2.92 days,and the mean bodyweight of 8 to 19 days of larvae fed with TT1 and TT3 reduced by 1.42%-17.37%and 10.77%-24.80%,respectively. The correctmortality of larvae fed with TT1 and TT3 during 4 to 18 days were 9.52%- 49.32% and 11.11%-52.70%,respectively.The two transgenic clones also showed toxic effect on larvae. The toxigenicities of TT1 and TT3 during 12 to 18 days were 0.010-0.026 and 0.032-0.041, respectively,and the exuviation index of larvae fed with TT1 and TT3 were 2.969-3.769 and 2.906-3.714,respectively.TT3 is better than TT1 in every index. |