Influence Lycopene Content Through Lcy Gene Silencing Mediated By RNAi | | Posted on:2008-03-13 | Degree:Doctor | Type:Dissertation | | Country:China | Candidate:Q Wan | Full Text:PDF | | GTID:1103360215965495 | Subject:Horticulture | | Abstract/Summary: | | | Lycopene is a kind of crude pigment and is a part of carotenoid. Some other carrots are formed by the cycled lycopene. The tomato (Lycopersicon esculenrum Mill.) fruits, watermelon and the roots of carrot are the main dietary of lycopene. Lycopene distributes in the whole tomato fruits and the lycopene content in the tomato fruits is the highest. Because it can regulate and defend some diseases such cancers and is no side effect to body lycopene is regarded as the nutritive health protection food. In the dietary of West countries, the lycopene is very popular and is authorized to be used in the foodstuff and medicine. Lycopene is biosynthesized in the plastid and chloroplast, the biosynthesized pathway as follows: phytoene is transformed into the lycopene by the regulating of several desaturases. Then the lycopene is transformed into theβ-carotenoid andε-carotenoid under the regulating of lycopene cyclase. If the expression of Lcy gene in the tomato fruits is suppressed by RNAi the transformation of Lcopene will be blocked and the lycopene will accumulate in the tomato fruits.Tomato is one of the most wide plant and popular vegitable in the world. There are abundant of Va, Vc and lycopene in the tomato fruits so the tomato fruits are the good foodstuff for the good looking. The tomato fruits can be consumed as the vegitable or fruitage. Tomato also has the important action in the biotechnology research. There is wide and in-depth research to the tomato in the physiologica and biachemica aspect. So the tomato is the cmopatible transgenic material for the elevation of lycopene content by gene engineering way.The Lcy DNA segment and the Pds promoter were amplified from the tomato genome DNA according to the sequences published on the GenBank. Then the promoter was cloned into the expressive vector to regulate the expression of GUS gene. The promoter with the GUS gene was introduced into the disinfected tomato by trangene. The nature of the Pds promoter was analysis after the transgenic tomato was harvest. The result showed that the promoter had the fruit-specific nature. The RNAi construct was designed according to the theory of RNA depend RNA polymerase (RdRP ) leading to the gene silencing as following: 3' end of interve-repeat sequence was ligated by an intron fragment and the direction of intron was the same as that of genic transcription .When the dsRNA gene was introduced into the tomato plants the expression of Lcy gene of tomato plants was suppressed. So the lycopene content in the tomato fruit was increased. The fruit-specific silencing of Lcy gene is a new and high efficient way to increase the nutritional value of the tomato fruits at present. This study would initiate a new road for elevating the nutritional value of plant products by transgenic technology. The experiment involved the following aspects:1. The isolation of Pds promoter and Lcy segmentTomato genomic DNA was extracted from tomato leaves by modified CTAB and was used for DNA amplification. According to the sequence of tomato Lcy gene published in the GenBank (X86452) , the primers were designed as follows:P166: 5' CTA TGG TGT TTG GGT GGA TG3' ; P167: 5' GTG CTC GAT GCA ACT GGC TTC TCT A3' The DNA segment of Lcy was isolated by PCR from the tomato DNA.The segment of intron was isolated from the GUS gene of pCAMBIA1301 expressive vector, the primers were designed as follows:P44; ATGACGCACAATCCCACTATC CP168: GCGGATCCCGTCGGTTCTGTAACTBamH I2. Isolation and function analysis of Pds promoterAcording to the sequence of tomato Pds promoter published in the GenBank (U46919) , the primers were designed as follows:P164: 5' GAG CAG GTA AAA GCT TCA ATG CCC T3';P165: 5' GAA GAT ATA GGG AGT GGT TCT GCA C3' .The DNA segment of Pds promoter was isolated by PCR from the tomato genome DNA.The result of sequencing showed the sequence of the Pds promoter was the same with the sequence published on the GenBank. The Pds promoter was inserted into the pVCT2020 expressive vector to replace the 35S promoter of GUS gene to regulate the GUS gene expression. Then the promoter with the GUS gene was introduced into the tomato by Agrobacterium tumefaciens. After the transgenic tomatoes were harvested, the fruits, leaves, roots were dyed by the X-Gluc for 5h. The results showed that. The Pds promoter had the fruit-specific nature. The intron in the leader sequence of the 5' end was not the necessary sequence for the high level expression of promoter. This experiment just did the primary research to the promoter. More experiments are needed to do to know the function of the promoter further.3. Construction of the fruit-specific RNAi expressive vectorThe pMD-Lcy vector plasmid was cut by the Sal I restriction enzyme to generate the vector fragment with the stick end. Then the stick end of the vector fragment was flat by the Klenow enzyme to inform the vector fragment with blunt end. The Lcy fragment was cut from the vector fragment with blunt end by the BamH I enzyme and was cloned to the pMD-Lcy plasmid vector cut by the Sma I + BamH I enzyme to inform the pMD-srLcy construct with inverted-repeat fragment of Lcy. Then the intron was ligated with the pMD-srLcy construct cut by the BamH enzyme and removed the phosphate radicle by the CIAP to inform the pMD-RNAi construct with inverted-repeat fragment ligated by the intron. Then the inverted-repeat fragment ligated by the intron cut from pMD-RNAi plasmid and Pds promoter fragment cut from the pMD-Pds plasmid were cloned to the pVCT2020 expressive vector to inform the pVCT-PdsRNAi expressive vector with fruit-specific promoter. Then the promoter with the RNAi gene was transformed into the Agrobacterium tumefaciens (LBA4404).4. Establishment of regeneration and transformation systems of tomatoIn order to generate transgenic tomato plants, the tomato seeds were washed 2-3 times by the soap water and sterilized by the 10% sodium hypochlorous acid for 30 min then the sterilized seeds were washed by the sterilized water for 3 times to obtain the disinfected tomato seeds. After the disinfected seeds were transferred to the 1/2 Murashige and Skoog (MS) culture medium and cultivated in the dark for 3d the seed began to germinate.The germinated seeds were cultivated in the light until the cotyledon spreaded completely (about 7d). After cotyledon spreaded completely the spreading cotyledons were cut and cultivated on the differential culture medium(MS + 0.2 mg/LIAA+ 1mg/L6-BA+ 3%Sucrose)to compare the ability of cotyledon and nether hypocotyl differentiating bud, the result showed the cotyledons were easier to differentiate the bud than the nether hypocotyls. So the cotyledons were selected as the transgenic materialsThe explants were cultivated in the MS culture medium with different hormone and concentration to select the most compatible culture medium for the regeneration and rootage of tomato explants. The results showed that the culture medium (MS + 1.0 mg/L 6-BA + 0.2 mg/L IAA) was most compatible medium for the bud differentiation and the most compatible IAA concentration for the rootage was 0.3 mg/L.In order to test the sensitivity of explants on Kanamycin(Kan), cotyledons were cultured on the bud induction medium with 0-70 mg /L Kan. The result showed that the 50 mg/L Kan concentration was an appropriate selective concentration for tomato explants regeneration.5. Plant transformationAfter 2 d of pro-cultivation in the dark cotyledons explants were infected for 8 - 10 min by the liquid Agrobacterium tumefaciens LBA4404 with the pVCT-PdsRNAi construct, suspended by the liquid MS culture medium to the concentration of OD600=0.4. Then the infected cotyledons were co-cultivated on the differential culture medium in the dark. After 2 d the cotyledons were cultivated on the culture medium with Cefotaxime (MS + 0.2 mg/L IAA + 1 mg/L 6-BA + 3% Sucrose + 300 mg/L Cefotaxime, Cb ) for 7 d to prevent bacteria growth. Then the explants were transferred to the selective culture medium adding the Kanamycin (MS + 0.2 mg/L IAA + 1 mg/L 6-BA + 3%Sucrose + 300 mg/L Cb + 50 mg/L Kanamycin,Kan) to select the resistive explants. Two weeks later the resistive explants began to differentiate the buds. When they grew to 3-4 cm length the resistive buds were cut and transferred to rootage medium (MS + 0.3 mg/L IAA + 3% Sucrose + 50 mg/L Kan) to induce the rootage. One month later the plantlets were transferred to the greenhouse where they had grown until harvesting the mature tomato fruits.In the course of Agrobacterium tumefaciens infecting the explants if the concentration of liquid bacterial was too thick the explants were easy to become brown, bad and even to death in the later culture and if the concentration of liquid bacterial was too sparse it was difficult to obtain the transgenic plants. The result of this experiment showed that the OD600 value of liquid Agrobacterium tumefaciens among 0.3 to 0.6 was the most compatible concentration for the tomato explants infect. It was very useful using the liquid MS culture medium to re-suspend the Agrobacterium tumefaciens because this method can decrease the bad effect produced by Agrobacterium tumefaciens on the explants and increase the surviving rate of explants. After the explants cultivated on the differentiated culture medium for 2 weeks some explants began to differentiate and a month later some explants began to differentiate the crude buds. The buds began to take the roots on the rooting medium one week later.6. Detection of the tranformants The genomic DNA was extracted from the transgenic tomato plants for PCR analysis. The DNA of wild-type tomato plants was set for the negative control. The single primer P166 was use for PCR analysis. The system and condition of PCR reaction were the same with amplifying the Lcy DNA fragment.Seven transformants were obtained through the resist choice. The results of PCR detecting showed that the target fragments amplified from five tranformants were the same as that from the positive control and the other two tranformants were not amplified the target fragment, that is to say there were five really transgenic plants among the seven tranformants. The five transgenic plants had grown in the greenhouse until produce the mature transgenic tomato fruits.7. Analysis of lycopene in the transgenic tomato fruitsFull red-ripe greenhouse fruits (three fruits per plant), between 15 to 20d post-breaker stage (breaker is defined as the first external appearance of red color at the blossom end of the fruits), were harvested for lycopene analysis. After the fruits were skived into the paste lycopene was extracted from the 10 g tomato fruits paste of every sample by adding 40 mL chloroform . Then the samples were kept in 35℃and dark. Four hours later the samples were shaken vigorously and then centrifuged into separate phases. Then the lower liquid was transferred into other centrifugal tube. The dreg was used for extracting lycopene again in 20 mL chloroform. Lycopene was detected by the U-1800 UV spectecphotometer at the 502 nm. Because it was very expensive and easy to denaturalize the lycopene standard sample was replaced by Sudan I for protracting the standard curve.The lycopene content in 100 g fresh tomato fruits was set as the vertical coordinates, the markers of wild-plant and transgenic plants were set as the across coordinates to draw the coordinates figure. Chemical analysis to lycopene of tomato fruits from 5 transgenic plants revealed that lycopene content of every transgenic tomato fruits was present at higher levels, the average lycopene content of five transgenic tomato fruits was generated up to 2.1 times and the mark 1 transgenic plant showed the most dramatic increases, which was up to 2.6 times than that of wild-type fruits. | | Keywords/Search Tags: | Tomato, RNAi, Pds Specific-fruit promoter, Lycopene | | Related items |
| |
|