| Skeletal muscle comprises as much as 45%60% of an animal's body mass. Hence there is much interest in understanding the development, physiology and metabolism of this tissue. Different pig breeds due to the difference of origin, local environment, feeding and selected traits have different intrinsic features, and there is a large difference between their muscle traits. When two breeds that have different traits are crossed, F1 hybrids tend to demonstrate hybrid vigor and have superior muscle traits. Further understanding on gene structure and function has indicated that the trait difference and heterosis are in fact the external exhibition of gene expression and regulation. Thus, we constructed forward and reverse subtracted cDNA libraries between Longissimus muscles from Meishan and Landrace pigs, Fl hybrids Landrace X Yorkshire and their female parents Yorkshire by suppression subtractive hybridization (SSH) technique in order to clone and identify the differentially expressed genes responsible for the trait difference and heterosis. The findings are as follows:1. A housekeeping gene, G3PDH, was used to estimate the subtraction efficiency. In each subtracted cDNA library, G3PDH was subtracted very efficiently at more than 25 folds, and some even near 210 folds, indicating that some differentially expressed genes were also enriched at the same folds and the subtracted cDNA libraries were very successful.2. More than 800 clones were randomly selected from each subtracted cDNA library. By PCR analyses, 759 and 773 positive clones were isolated from the subtracted cDNA libraries, by Meishan as Tester, Landrace as Driver and Yorkshire as Tester, Landrace×Yorkshire as Driver, respectively. Most of all plasmids in the clones contain 150750 bp inserts.3. By forward subtractive cDNA, reversal unsubtractive cDNA and reversal subtractive cDNA as probes, high-throughput screening was carried out. In the subtracted cDNAlibrary by Meishan as Tester and Landrace as Driver, 27 differential expressed clones were obtained. Further analyses showed they represent 14 porcine ESTs. Of 4 are known in pig, 7 are unknown in pig but have a high similarity with human and other species genes, and 3 have no significant similarity with known genes. In the subtracted cDNA library by Yorkshire as Tester and LandracexYorshire as Driver, 24 differential expressed clones were obtained. Further analyses showed they represent 12 porcine ESTs. Of 5 are known in pig, 7 are unknown in pig but have a high similarity with human and other species genes. In addition, most of these differential expressed ESTs were subjected to further identification by semi-quantitative RT-PCR analysis with an inner control4. Using in silico cloning and SMART technology, we obtained 7 full-length cDNA: (1) CCNGl, GenBank accession number AY974246, full-length cDNA 2359 bp, ORF 888bp; (2) EEF1A, full-length cDNA 1777 bp, ORF 1389 bp; (3) ETFB-like, full-length cDNA 898 bp, ORF 765bp; (4) HUMMLC2B, GenBank accession number AY754870, full-length cDNA 681bp, ORF 510 bp; (5) PGK1, GenBank accession number AY677198, full-length cDNA 1789 bp, ORF 1254 bp; (6) TXNIP, full-length cDNA 1880 bp, ORF 1176 bp; (7) CKM, GenBank accession number AY754869, full-length cDNA 1572 bp, ORF 1146 bp. CCNGl, EEF1A and ETFB-like demonstrate high-level expression in Meishan pigs. HUMMLC2B, PGK1, TXNIP and CKM demonstrate down-regulated expression in Fl hybrid LandracexYorshire pigs.5. Using CLUSTAL W and some related softwares, we analyzed the gene structure, protein structure, conserved motifs and phylogenetic relation of genes CCNGl, EEFl A, ETFB-like, HUMMLC2B, PGK1, TXNIP and CKM. In addition, the corresponding phylogenetic trees were constructed.6. Using semi-quantitative RT-PCR with an inner control, we carried out the temporal and spatial expression analyses in different pig breeds (Yorkshire; MeishanxYorkshire; YorkshirexMeishan; LandracexYorkshire; Landrace; Meishan; Duroc; Tongcheng), different development stages (embryo; neonate; two months old; four months old; six months old) and different tissues (heart; liver; spleen; lung; kidney; pancreas; small intestine; stomach; uterus; ovary; testis; adipose tissue; biceps femoris; semispinalls capitis; longissimus dorsi).7. Using PCR-Walking, we obtained 3 genes' full genomic sequences containing all introns and 2 genes' partial genomic sequences, and analyzed their polymorphisms in different pig breeds. (1) CCNGl, 7491 bp, containing 6 introns and 7 exons. In whole genomic sequence, we identified 23 SNPs. Of 4 are transversion mutations, 17 aretransition mutations, 1 is insertion mutation and 1 is deletion mutation. In addition, there is an "AATGAATCTGTGTACTGAATC" insertion in intron 2 of Yangxin pig's CCNG1. (2) HUMMLC2B, 2936 bp, GenBank accession number AY870651, containing 6 introns and 7 exons. In exon 4 to exon 7 (containing partial exon 4 and exon 7), we identified 13 SNPs. Of 4 are transversion mutations, 9 are transition mutations. In addition, there is a GA—TC mutation in intron 4. (3) TXNIP, 3331 bp, containing 7 introns and 8 exons. In whole genomic sequence, we identified 11 SNPs. Of 3 are transversion mutations, 8 are transition mutations. (4) PGK1, 1105 bp (containing partial exon 9 and exon 11, complete intron 9, 10 and exon 10), we identified 8 SNPs. Of 1 is transversion mutations, 7 are transition mutations. (5) KIAA1717, 2032 bp (3' UTR), GenBank accession number AY900164, we identified 3 SNPs. all are transition mutations. The locations of splice donor/acceptor sites in all introns follow the "GT/AG" rule.8. Using PCR-RFLP, we detected 4 SNPs in different pig populations and observed associations with traits in YorkshirexMeishan F2 population. The results showed: MS60-2-iVco I -RFLP is significant association with intramuscular fat (p<0.01) and water moisture (p<0.01). MS60-345-l-IspE I -RFLP is significant association with buttock backfat thickness (p<0.01), shoulder backfat thickness (p<0.05), 6-7th thorax backfat thickness (p<0.05), average backfat thickness (p<0.05) and water moisture (p<0.05). DB245-2-Msp I -RFLP is significant association with loin eye width (p<0.05), loin eye area (p<0.05), longissimus doris pH (p<0.05), biceps femoris pH (p<0.01), drip loss rate (p<0.01), water holding capacity (p<0.01), longissimus doris color value (p<0.01), biceps femoris color value (p<0.05) and water moisture (p<0.01). DB37-Msp I -RFLP is significant association with fat meat percentage (p |
