Font Size: a A A

Pathogens And Antagonistic Bacteria Of Soft Rot Disease On Konjac

Posted on:2011-04-02Degree:DoctorType:Dissertation
Country:ChinaCandidate:J P WuFull Text:PDF
GTID:1103330332482911Subject:Genetics
Abstract/Summary:
Amorphophallus konjac is a perennial herbaceous species, which mainly grows throughout Southeast Asia and Africa. It is the only plant teeming with Glucomannan. Glucomannan has many special physical and chemical properties, and has been widely used in food industry, chemical industry, pharmaceutical industry, petroleum drilling, construction, agriculture and so on. With the increasing global demand for konjac products, while the crop farming of konjac in Japan declined gradually because of the land and aging problem, it brings a great opportunity for Chinese konjac industry. With the expansion of konjac field, the diseases are more and more serious. Especially the soft rot disease sometimes could destroy all the konjac in the affected area. The soft rot of konjac was systemic disease, mainly spread by sick corms and soil. Until now there is no efficient way to control the disease. In order to provide theoretical basis, methods and genetic resources for disease prevention and resistant breeding, the genetic diversity of soft rot pathogens were studied, the new method to detect the quantity and species of soft rot pathogens was established, and the infection pathways were primarily studied. Moreover, an antagonistic bacterium for the soft rot pathogens of konjac was screened and a new soft rot pathogen of the konjac was found. Main research results in this study were followed:(1) Thirty-three strains of soft rot pathogens were isolated from infected konjac samples, which collected from different regions. Through the morphological observation, physiological and biochemical determination, pathogenicity tests,16S rDNA sequencing and phylogenetic analysis, the results showed that the pathogens were Pectobacterium carotovora subsp.carotovora (P.c.c.) and Pectobacterium chrysanthemi (P.ch), and the P.ch was the main type of pathogens. Besides, there were two types of pathogens found in one certain region. In the phylogenetic tree, two clades were constructed by P.c.c.and P.ch.samples, respectively. The genetic varieties were significant within the pathogen species, but genetic differentiation was not based on the geographic area.(2) Based on the 16S rDNA sequences of the soft rot pathogens, one pair of specific primers (F/R:ATGCAACGCGAAGATCCTTAGGTAC/CATTGAAGCAC GTGTCTAGCCCTAC)were designed to identify the soft rot disease by real-time PCR and the other two (C1/C2:ATGCAACGCGAAGATCCTTAGGTAC/CAT TGA AGCACGTGTCTAGCCCTAC, H1/H2:CCTGAGTTCCCACCCGTAGTT/GCGA AGACTGCAGAGATGCCG)were used to identify the pathogens of P.c.c. and P.ch. respectively. The reaction conditions for real-time PCR and ARMS-PCR were optimized. According to the results, real-time PCR with the designed primer pair could detect one bacterium of the Pectobacterium while 100 times more accurate than the conventional PCR. Moreover, the two specific primers can directly and accurately distinguish P.c.c. and P.ch. by the ARMS-PCR system without testing the pathogenicity, biochemical and phenotypic characterizations and so on.(3) From macro-observation, the corms at the bottom 2/3 were immersed in bacterial suspension of soft rot pathogens without infection at the start stage, the intact corms were infected through the germination roots. At the same time, bud scales, roots and wounded corms appeared soft rot symptom after 24h. The soft rot pathogens can not directly invade the intact corms, but it can invade the infected bud scales, roots and wounded corms. From micro-observation, the epidermis of the corm had no stomas and lenticels, which was different from the soft rot pathogens of potato from the lenticels to infect. The stomas of the bud scales have no pathogens gathered around, which was equal to the mechanism of physiology incompatibility for the soft rot pathogens from the stomas to infect. Through the macroscopic and microscopic research, we confirmed that soft rot pathogens invade konjac through the wounds and the growth of the organizations rather than the natural openings for the first time, and the wounds was the main infection pathways. (4) An antagonistic bacteria for the soft rot pathogens of konjac was screened from the border of soft rot sample. Through morphological observation, physiological and biochemical determination,16S rDNA sequencing, the antagonistic bacteria might be Serratia marcescens. Then, the fermentation of optimal pH, carbon sources and nitrogen source were studied, and the antibacterial material was separated and analyzed. But whether it is a new antibacterial material and its molecular structure, physical characteristics need a further study.(5) A new soft rot pathogen of the konjac was found. Through morphological observation, physiological and biochemical determination, analysis of 16S rDNA sequence, the pathogen might be Enterobacter. sp. But the infection pathway and clonization of the new pathogen need a further study.
Keywords/Search Tags:Amorphophallus konjac, bacterial soft rot, antagonistic bacteria, infection pathways
Related items