| Persistent Toxic Substances(PTS) which affecting human survival and health,are known as the three major environmental problems in 21st century,as well as the greenhouse effect and ozone depletion.Whether the 21 categories of Persistent Organic Pollutants(POPs) identified in "the Stockholm Convention",the 12 categories of Persistent Bioaccumulative & Toxic Chemicals(PBT) identified by U.S.EPA,or the study of Environmental Endocrine Disruptors(EEDs),they are closely related with PTS.Polycyclic aromatic hydrocarbons(PAHs) and polychlorinated biphenyls(PCBs) are two types of typical persistent toxic substances.They are widely distributed in the environment,but mostly trace,and difficult to break down,with a high fat-soluble,water-insoluble,and easy to bioaccumulation.Moreover,they are not only carcinogenic,teratogenic and mutagenic,but also has the role of endocrine disruptors.Therefore they have an invaluable potential threat for biology and human health.The monitoring and analysis of PTS are the base and the important prerequisite of carrying out environmental risk assessment and implementation of prevention and control.At present,the most common methods used for analysis of PAHs and PCBs are gas chromatography(GC),high performance liquid chromatography(HPLC) and gas chromatography-mass spectrometry (GC/MS).However,these are known to manifest underlying disadvantages,such as the complexity of operating requirements for equipment,sample pre-treatment demanding,and they are also known to be time-consuming and expensive.Moreover,they are deemed unsuitable for detecting very low quantities of pollutants in the environment.Especially,they are not suitable for on-site rapid testing and large quantities of samples.Therefore,the development of effective bio-analysis techniques will be the direction of development in the future.Fluorescence immunoassay and fluorescence quantitative immuno-PCR technology are two very promising detection methods for its high immune specificity and high sensitivity without the need for complicated pre-treatment process.These immunoassay methods,which were known in the biomedical fields,are currently being used in the environmental monitoring field.This paper intends to select fluorescence immunoassay and real-time fluorescence quantitative immuno-PCR technique to detect the typical and representative pollutants of the PTS—PCBs and PAHs,and providing a scientific frame of reference for the study of environmental toxicology and governance in PTS.As we known,the nature of the fluorescent marker is important to fluorescent immune analysis technique.So the new type of fluorescent probe—quantum dots and molecular beacons will be used as fluorescent marker substances in fluorescence immunoassay and real-time fluorescence quantitative immuno-PCR experiments,so as to lower the background values,and improve the specificity,sensitivity and accuracy. In this paper,CdTe-based fluorescence immunoassay and MB-based real-time fluorescence quantitative immuno-PCR technique were established to detect PAHs and PCBs through the synthesis of CdTe quantum dot and designing of a specific molecular beacon for the pUC18 DNA. The main content and conclusions of this thesis are as follows:1,Preparation of CdTe quantum dot and optimization of conditions:The red water-soluble cadmium telluride(CdTe) was synthesized in four refluxing hours at 96℃in water phase with mercapto-acetate acid used as stabilizing agent.The fluorescence quantum yield is 66.92%.The characters of TEM and XRD diffraction patterns demonstrated good structural properties of CdTe. Various optimal conditions were obtained for preparation of CdTe in experiment.With the modification of carboxyl group to CdTe surface,the CdTe quantum dot has the function of biological tagging,and they are able to link to DNA,peptides and antibodies or antigen of related environmental persistent organic pollutants with the role of molecular coupling.And which laid the foundation for CdTe acting as a labeled probe in the analysis of environmental pollutants.2,Preparation and purification of biotinylated reporter DNA:The reporter DNA with biotin is a 123-base pair sequence from the pUC18 plasmid.The reporter DNA was generated by PCR as follows.The forward primer,M1341/pUC forward sequencing as CTGACTCCCCGTCGTGTAGA,was biotinylated at the 5' end to generate a biotiny group to the DNA.The reverse primer,M1342/pUC reverse sequencing as GCTGGCTGGTTTATTGCTGAT was also biotinylated at the 5' end to generate a biotiny group to the DNA.All regents were added to PCR tube as described by the DNA PCR kit handbook.The PCR conditions were:hold 94℃for 4 min;30 cycles of 94℃for 20 s,55℃for 20 s,and 72℃for 20 s;The 72℃step was extended to 3 min in the final cycle.The reporter DNA was purified and retrieved by UNIQ-10 PCR DNA Extraction Kit.The DNA was quantified by UV absorbency and checked qualitatively using agarose gel.3,Design and synthesis of molecular beacon:Based on the design principles of molecular beacon probes,we designed and synthesized a molecular beacon probe,which has specificity for pUC18 DNA.The sequence is: 5'-FAM-CAGCGATCTGGCCCCAGTGCTGCAATCGCTG-DABCYL-3 '.After investigating the specificity of the probe,the result showed that the molecular beacon could be specifically identified the complementary DNA during PCR.The specificity of the molecular beacon probe would be avoiding non-specific amplification throughout PCR cycle,reducing the background value,and obtaining greater sensitivity and accuracy.4,Direct competition fluorescence immunoassay:With the optimum conditions of the labeling and the CdTe acting as a fluorescent marker,we coupled the antibodies of naphthalene, fluoranthene,and PCB12 with CdTe successfully,And obtained the relevant fluorescent labeling reagent.These reagents were used in fluorescence immunoassay(FIA) for analysis of the related pollutants.After examining and optimizing FIA condition of influence factors,such as coating medium,coating time,ionic strength,pH,surface-active agent and antigen-antibody optimal working concentration,we established thereby the standard curve of the inhibitory rate of three kinds of pollutants in direct competition FIA,with the linear range of 102-103 ng/mL,and IC20 of naphthalene,fluoranthene,and PCB12 were 7.384pg/mL,9.046 pg / mL and 8.186 pg / mL, respectively.After examining the specificity,recovery and precision in the detection of environmental samples,we obtained satisfactory results.5,Antibody-coated fluorescence immunoassay:With the optimum conditions of the labeling and CdTe acting as a fluorescence marker,we coupled the antibodies of naphthalene,fluoranthene, and PCB12 with CdTe successfully,and obtained the relevant fluorescence labeling reagents. These reagents were used in fluorescence immunoassay(FIA) for analysis of the related pollutants. After examining and optimizing FIA conditions of influence factors,including the coating medium, coating time,ionic strength,pH,surface-active agent and antigen-antibody optimal working concentration,we established thereby the standard curve of the inhibitory rate of three kinds of pollutants in antibody-coated FIA,with the linear range of 10-2-103 ng/mL,and IC20 of naphthalene,fluoranthene,and PCB12 were 13.95 pg/mL,15.94 pg / mL and 12.94 pg / mL, respectively.After examining the specificity,recovery and precision in the detection of environmental samples,we obtained satisfactory results.6,Direct competition real-time fluorescence quantitative immuno-PCR:We detected polycyclic aromatic hydrocarbons-naphthalene,anthracene and fluoranthene in the environment by real-time fluorescence quantitative immuno-polymerase chain reaction(direct competition RTFQ-IPCR) using a molecular beacon probe.Coating antigens adsorbed to the PCR tubes treated with glutaraldehyde,is used to competing with the PAHs in combining biotinylated antibodies.Avidin is used as a bridge between the biotinylated antibodies and the biotinylated reporter DNA.The reporter DNA is amplified and measured by RTFQ-PCR under the optimum procedure.Standard curves of the three PAHsnaphthalene, anthracene and fluoranthene were produced.And the linear range of 1-104 fg/mL, 10-105 fg/mL,and 10-107 fg/mL were obtained,with limits of detection of 0.81,5.94,and 3.84 fg/mL,respectively,and good correlation.Some environmental samples were analyzed with satisfactory results,including specificity and recovery rate.Actual results were compared with the ELISA determination,with good consistency,indicating that the method for the detection of environmental persistent toxic pollutants is feasible and effective.7,Indirect competition real-time fluorescence quantitative immuno-PCR:We detected polycyclic aromatic hydrocarbons)—phenanthrene in the environment by real-time fluorescence quantitative immuno-polymerase chain reaction(indirect competition RTFQ-IPCR) using a molecular beacon probe.Coating antigens adsorbed to the PCR tubes treated with glutaraldehyde,is used to competing with the phenanthrene in combining antibodies (primary antibody).Then the biotinylated goat anti-rabbit IgG(second antibody) were added to combine with the primary antibody,Avidin is used as a bridge between the biotinylated goat anti-rabbit IgG and the biotinylated reporter DNA.The reporter DNA is amplified and measured by RTFQ-PCR under the optimal procedure. Standard curves of phenanthrene were produced.And the linear range of 10-106 fg/mL was obtained,with detection limit of 5.34 fg/mL and correlation coefficient of 0.9747.Some environmental samples were analyzed with satisfactory results,including specificity and recovery rate.The results tested by indirect competition RTFQ-IPCR were compared with that from HPLC determination,indicating good consistency.And the differences are acceptable within the margin of error.8,Antibody-coated real-time fluorescence quantitative immuno-PCR:Using a molecular beacon as fluorescence probe,we determined polychlorinated biphenyl pollutants-PCB77 in the environmental by antibody-coated real-time fluorescence quantitative immuno polymerase chain reaction(antibody-coated RTFQ-IPCR).Coating antibody adsorbed to the PCR tubes treated with glutaraldehyde,is used to competing with the PCB77 in combining biotinylated hapten.Avidin is used as a bridge between the biotinylated hapten and the biotinylated reporter DNA.The reporter DNA is amplified and measured by RTFQ-PCR under the optimized procedure.Standard curves of PCB77 were produced. And the linear range of 10-105 fg/mL was obtained,with detection limit of 6.63 fg/mL and correlation coefficient of 0.9972.The antibody-coated RTFQ-IPCR was used in analysis of real environmental samples,and we obtained satisfactory results after examining the specificity, sample recovery.The results detected by RTFQ-IPCR were compared with that from GC/MS, showing a good correlation,and the differences between tow results are acceptable within the margin of error.This paper is the first time report on detecting successfully of polycyclie aromatic hydrocarbons and polychlorinated biphenyls by fluorescence immunoassay and real-time fluorescence quantitative immuno-PCR with CdTe quantum dot and molecular beacon probe acting as fluorescence-labeled probe,respectively.The results are satisfactory and reliable.And these methods provide a new research idea for detection and analysis of trace persistent toxic substances in the environment. |