Identification And Characterization Of Antimicrobial Peptides From The Skin Secretion Of A Chinese Frog (Rana Dybowskii)

PrefaceAntibacterial peptide (ABP) is a small molecule peptide generally containing amino acids from 10-50, with the features of broad-spectrum antibacterial activity, strong thermal stability, small molecular weight and immunogenicity and the bacteria difficult to produce resistant, which are expressed by all kinds of organism and also known as antimicrobial peptides (AMP) or peptide antibiotics. Such peptides are attracted increasing attention due to the growing problem of pathogenic microorganisms resistant to conventional antibiotics. Amphibians are among the first groups of organisms to form a connecting link between land and water and are thus forced to adapt and survive in a variety of conditions. Although their denudate and moist skin surface represents a potentially ideal habitat for microbial growth, they evolve an excellent chemical defense system consisting of pharmacological inhibitors and antimicrobial peptides. To adapt diversiform environmental habitatthe skin secretions of Ranid frogs, like other anuran species, contain peptides with distinctive amino acid sequences and broad-spectrum antimicrobial activity. R. dybowskii lives mainly in valley groves of the northeast of China. The skin of R. dybowskii has been used extensively in traditional Chinese medicine to heal open and burn wounds and the antimicrobial components may contribute to its efficacy in wound healing. To understand the biodiversity and nature of antimicrobial peptides from the skin of this frog, ABP was analyzed using both cDNA sequencing and mass spectrometry approaches. Novel peptides were then synthesized and assayed for biological function and secondary construction. Methods1. Identification and molecule diversity of antimicrobial polypeptidesfrom the skin secretion of R. dybowskii(1)Shotgun cloning of antimicrobial peptide precursor cDNAsRT-PCR was carried out with total RNA that had been isolated from cell lysate prepared from a single frog skin. First strand synthesis was carried out using the primer 5'-CTGATCTAGAGGTACCGGATCCTTTTTTTTTTTTTTTTTT-3' by incubation at 50℃for 30 min for the reverse transcription, followed by 95℃for 15 min for denaturation of the reverse-transcriptase. Subsequently, the PCR was performed under the following conditions: 30 s at 94℃, 30 s at 55℃and 1 min at 72℃for 30 cycles. The sense primer (5'-CTG ATC TAG AGG TAC CGG ATC C-3') and degenerate primer (5'-ATG TTC ACC WTG AAG AAA-3') were designed based on the oligo dT18 5'-region and conserved 5'regions of the previously reported antimicrobial peptides. The amplified DNA fragments were excised and purified using an AxyPrepTM DNA Gel Extraction Kit and AxyPrep^TM PCR clean Kit (Axygen Scientific,Inc), subcloned into a pGEM-T vector with an Acceptor Vector Kit (Promega, Madison WI), and transformed into E. coli JM109 competent cells (Promega). Plasmids were purified from the cells using a Quantum Prep plasmid miniprep kit (BioRad, Hercules, CA). Nucleotide sequence was performed by TaKaRa Biotechnology Co., Ltd. (Dalian, PR. China).(2) Peptide mass-spectrum analysisElectrospray ionization tandem mass spectrometry (ESI-MS/MS ) was carried out with a hybrid quadrupole orthogonal acceleration tandem mass spectrometer (Q-TOF2, Micromass Ltd., Manchester, UK). MS/MS spectra were transformed using MaxEnt3 (MassLynx, Micromass Ltd.), and ammo acid sequences were interpreted manually using PepSeq (BioLynx, Micromass Ltd.)(3)BioinformaticsThe theoretical molecular weights and pIs of identified proteins were calculated from the predicted amino acid sequences by using the ProtParam tool at the Expasy website (http://www.expasy.ch/tools/protparam.html). The grand average hydropathy (GRAVY) values were calculated by the method of Kyte and Doolittle by using ProtParam.2. Structures and biological character of antimicrobial polypeptide identified from the skin secretion of a Chinese frog (Rana dybowskii)(1)Biochemical synthesis of peptidesSeveral mature peptides were synthesized by solid-phase synthesis method using amino acids protected at the N_α-position with Fmoc or Boc. Wang resin and Rink Amide-MBHA resin was used as the support to obtain a carboxylated C-terminal peptide. The crude peptides were firstly subjected to the Sephadex^TM G-15 column chromatography using 10% (v:v) phosphoric acid/double distilled water as the eluent. The synthesized peptides were analyzed by RP-HPLC and electrospray ionization mass spectrometry (ESI-MS).(2)Circular dichroism analysis of peptidesThe circular dichroism (CD) spectrum of the identified polypeptide was recorded at 25℃using a Jasco J-715 circular dichroism spectrophotometer. Spectra were recorded in a 1 mm path length cell at a peptide concentration of 100μM in two solvents:(1) 10 mM sodium phosphate buffer, pH 7.0 and (2) 10 mM sodium phosphate buffer, pH7.0 containing 50% (v/v) 2,2,2-Trifluoroethanol.(3) Antimicrobial assaysAtimicrobial activity was analyzed by the method of agar plate and minimum inhibitory concentrations (MIC) were determined by standard micro-dilution assays previously described.(4) Hemolytic assayHemolysin test and blood plate were used for hemolytic assay.(5) StabilityDealing with antimicrobial peptide by methods as follow: 0.25% trypsogen digesting 1h, freeze thawing repeatedly, boiling 5 min and 30min, then CFU counting method was used to test activity.3. Expression, activity and structure of dybowskin-2CDYa : a novel antimicrobial polypeptide identified from the skin secretion of a Chinese frog (Rana dybowskii)(1)Gene splicing by overlap extension PCR was used to amplify dybowskin-2CDYa gene. Primers were designed according to the sequence of dybowskin-2CDYa: Zα15'CCGCTCGAGAAAAGAGAGGCTGAAGCTTCCGCTG TTGGTAGACACGGTAGAAGATTCGG3',Zα25'CTAGTCTAGAAATCATCAGT GCTTTCTGTGCTTTCTCAAACCGAATCTTCTGGAGTGTC3',Za115'CCGCTC GAGAAAAGAGAG3'å’ŒZα9K5' CGGAATTCCTAGTCTAGAAATCATCAGT3', and restriction enzyme cutting site Xho I,Xba I were added.(2)Plasmid construction and expressionThe mature peptide gene sequence of dybowskin-2CDYa was subcloned into the expression vector pPICZαA. The plasmid was transformed into Pichia pastoris GS115, and the recombination peptide was expressed by the methanol induction. The expression production was detected by antimicrobial activity, RT-PCR, and HPLC.(3) Protein level assayingBCA was used to quantitate the total protein concentration, and then caculated the quantitation of recombined petide.(4)Expression product purification and activity analysisRotary evaporation, gel filtration chromatography and HPLC were used to condense supernate fluid and purify antimicrobial peptide. Atimicrobial activity wasanalyzed by the method of agar plate, and blood plate were used for hemolytic assay.(5) Circular dichroism analysis of peptidesThe circular dichroism (CD) spectrum of the identified polypeptide was recorded at 25℃using a Jasco J-715 circular dichroism spectrophotometer. Spectra were recorded in a 1 mm path length cell at a peptide concentration of 100μM in two solvents:(1) 10 mM sodium phosphate buffer, pH 7.0 and (2) 10 mM sodium phosphate buffer, pH7.0 containing 50% (v/v) 2,2,2-Trifluoroethanol.Results1. Peptide sequence analysisApproximately 200 clones were randomly picked out and sequenced and 42 complete cDNAs were found to encode 14 speculative antimicrobial peptide precursors. Through the alignment of amino acid sequences using SWISS-PROT databases and the APD, all the 14 peptides were found to have significant amino acid sequence similarities with other antimicrobial peptides previously isolated from the Ranid species, but hypervariable mature peptides possessed the species specificity. It is worth noting that all of the antimicrobial peptide precursors contain exactly 22 amino acids in the signal peptide, initiated by a methionine residue. The best point for peptidase cleavage of the signal peptide was predicted to occur at the Cys-Glu amino acid .The acidic spacers for all the peptides were comprised of about 20 residues, followed by a typical Lys-Arg endoproteolytic cleavage site. MS analysis shows the molecule weights are from 1000 to 3000, and their amino acid sequences were quite coincident with speculative ones from cDNA.2. Similarity analysis of primary structureAccording to the similarity of primary structure, 4 of the 14 predicted mature peptides belonged to the temporin family (temporin-CDYa, temporin-CDYb, temporin -CDYc, temporin-CDYd) , 4 belonged to the brevinin -1 family (brevinin-1CDYa, brevinin-1CDYb, brevinin-1CDYc, brevinin-1CDYd), and 1 named japonicin-1CD Ya belonged to japonicin-1 family. The other three identified peptides, dybowskin-1CDYa, dybowskin-2CDYa and dybowskin-2CDYb, show little amino acid composition and sequence similarity to previously reported antimicrobial peptides, which should belong to two novel families of antibacterial peptide.3. Sencondary structure of R. dybowskii antimicrobial peptidesCircular dichroism spectrum of R. dybowskii antimicrobial peptides showed twominima at 208 and 222 ran, expresenting an a-helical conformation in phosphate buffer, and a random coil constructure in 50 % Trifluoroethyl alcohol / phosphate buffer and phosphate buffer.4. Antimicrobial and hemolysis assayBesides of temporin-CDYe, all the peptides showed a stronger antibacterial effect against the microorganisms. Dybowskin-1CDYa was the most effective, and the MIC was 3μM for E. coli, and 6μM for S. aureus. Besides of brevinin-1CDYa and japonicin -1 whose 50% hemolysis value (HC₅₀) was 180μM, others did not cause hemolysis at concentrations as high as 450μM.5. Expression, activity and structure of dybowskin-2CDYaMature peptide gene sequence of dybowskin-2CDYa was subcloned into the expression vector pPICZαA. The plasmid was transformed into Pichia pastoris GS115, and the recombination peptide was expressed by the methanol induction. The results of RT-PCR and HPLC show that the target gene has been inserted into the genome of the host and can be transcribed. RP-HPLC results show that the expression product is 0.83mg/mL. Activity test results show that dybowskin-2CDYa has anti-bacterial and low hemolysis activity. Dybowskin-2CDYa expresenting an a-helical conformation in phosphate buffer, and a random coil constructure in 50 % Trifluoroethyl alcohol / phosphate buffer.Conclusion1. One individual frog can express at least 14 kinds of antimicrobial peptide. Consisting with the peptides identified from other frog, their signal peptide and prepropeptide are very conservative, and mature peptides are high variable. Besides peptides have been reported, R. dybowskii also express the novel peptides, which have srong antimicrobial activity and low hemolysis activity.2. R. dybowskii peptides contain amino-acid residue from 13 to 33. Most of them are basic and positive charge polypeptide, and isoelectric point is more than 8. The secondary construction of the peptides identified from the skin of R. dybowskii shows a-helical structure except for dybowskin-1CDYa.3. Synthetic peptides have fifferent activity against Gram-Positive bacteria Staphylococcus aureus and gram-negative bacteria Escherichia coli. Dybowskin-1CDYa possess the highest antimicrobial activity (MIC 6μg/ml and 3μg/ml), and low hemlysis activity (HC₅₀＞450μg/ml).4. Antimicrobial peptides of R. dybowskiih have better stability, which can retain antimicrobial activity under the condition of boiling and freeze thawing repeatly. But it is sensitive to trypsogen.5. Pichia GS115 can express dybowskin-2CDYa correctly and the quantity of expression product is about 0.83 mg/mL.6. dybowskin-2CDYa possesses anti-bacterial and low hemolysis activity. Dybowskin-2CDYa expresent a a-helical conformation in phosphate buffer, but a random coil constructure in 50 % Trifluoroethyl alcohol / phosphate buffer.