| Backgrounds:Hypertension, one kind of chronic cardio- and cerebro-vascular diseases, is the main risk factor of coronary heart disease (CHD) and cerebral apoplexy. It is reported that more than 12,000 thousands of people died from the cardio- and cerebro-vascular diseases resulted from hypertension every year all over the world. Now, hypertension has become the first enemy of people's health, and the great public sanitary problem in the world. So far, six kinds of medicines are authorised to be applied to the treatment of hypertension by the World Health Organization (WHO), including diuretics, α -receptor blocking agent, β -receptor blocking agent, angiotensin receptor antagon, calcium channal blocking agent and angiotensin converting enzyme inhibitors (ACEIs).Renin-angiotensin system (RAS) plays an important role in the regulation of peripheric blood pressure, where angiotensin converting enzyme (ACE) is considered to be the core of the system. ACE plays a key role in increasing the blood pressure by catalyzing the formation of the potent vasopressor angiotensin II (Ang II) from angiotensin I (Ang I). ACEIs show ACE inhibitory activity and then regulate the blood pressure by inhibiting the formation of Ang II. Nowadays, ACEIs are widely used in the therapy of hypertension. However, for the side effects of such medicines, food protein-derived ACEIs, known as angiotensin converting enzyme inhibitory peptides (ACEIPs), which are considered as safer and more natural, have received great interests in the therapy of hypertension.Some peptides have been isolated and identified from the tryptic hydrolysate of milk casein and demonstrated ACE inhibitory activity and antihypertensive effects in vitro and in vivo, respectively. Such results have greatly promoted the research of milk-derived antihypertensive peptides (AHPs). However, by far, all the milk-derived antihypertensive peptides (also known as angiotensin converting enzyme inhibitory peptides, ACEIPs) are produced by the proteinase hydrolysis of milk proteins, no report is available on ACEIPs expressed by DNA recombinant technology.Objectives:In this study, our objectives are: ①to study the expression profiles of milk-derived antihypertensive peptide CEI12 in E.coli.; and ②to investigate the possibility of mass production of milk-derived antihypertensive peptide CEIn by recombinant technology . Designs:According to the amino acid sequences and genetic codons, a DNA fragment encoding the published ACEIP, identified as FFVAPFPEVFGK (known as CEIn) was synthesized (5' CGCGGATCCCGCTTCTTTGTGGCGCCGTTCCCGGAAGTTTTCGGCAAAGGATCCAGA 3') After digested with BamHI, the DNA fragment was ligated with fusion expression vector pQE16 and transformed into E. coli. JM109, E.Coli. BL21 and E.Coli. DH5 α . The positive colonies that grew on the ampicillin (Amp) plate (LB agar medium contaning 100 μ g/ml Amp) were screened and identified. SDS-PAGE and Western blot analysis were performed to study the expression profiles of target gene CEIn in E. coli. JM109, E.Coli. BL21 and E.Coli. DH5 a at different IPTG concentration and different times. Finally, the growth conditions, growth curves, fermentation conditions of recombinant strains and the biological properties of purified recombinant protein were investigated. Results:Target gene CEI12 was expressed in E. coli. JM109 and E.Coli. BL21, but not in E.Coli. DH5α . The expression level was about 500 μ g/L culture in E. coli. JM109 and 1.2mg/L culture in E.Coli. BL21, respectively.No significant difference was observed on the expression levels of CEIn at different IPTG concentration and differet times in recombinant E. coli. JM109 and recombinant E.Coli. BL21. The optimum condition was 5-6h at Immol/L of IPTG After long-time induction of recombinant E.Coli. BL21, the highest expression level was found at 12h after IPTG induction. However, no significant difference was observed on the expression levels of CEIn between 12h and 6h after IPTG induction.Significant differences were seen between the car...
|
PDF Full Text Request