Font Size: a A A

Effect Of Mutations Of Activating Gene Element In SV40PolyA On GFP Reporter Gene Expression

Posted on:2012-12-20Degree:DoctorType:Dissertation
Country:ChinaCandidate:H G WangFull Text:PDF
GTID:1100330335478974Subject:Biochemistry and Molecular Biology
Abstract/Summary:
Objective:There are a lot of non-coding sequences in human and mammalian genome. It is not clear about the function of most non-coding sequences. The researches of the gene regulation mechanism and the new biological function of non-coding sequences are important to study the biological behaviors of human and mammalian, including differentiation and senility. Our work previously reported two activating gene sequences in early mRNA SV40PolyA, namely, 17bp fragment: 5′-AAAAAAATGCTTTATTT-3′(actually, the 22bp sequence including 17bp fragment was used in this study) and 29bp fragment: 5′-ATAAACAAGTTAACAACAACAATTGCATT-3′, both of the two fragments can relieve the inhibition of GFP gene induced by Alu tandem sequences. We analyzed the two fragments and found that they both included imperfect palindrome, so the activating gene sequences were named imperfect palindrome. The imperfect palindrome could form unstable stem-loop. With the development of structural genome and proteomics research, it is clear about the majority elements in cells, the puzzle problems for biologists (such as the mechanism of differentiation, senility and epigenetic inheritance) possibly involve the unknown functions of known elements. In this study, we proposed that the imperfect palindrome of DNA could form unstable stem-loop structure, DNA changed from stem-loop structure to DNA double strands unceasingly to form dynamic DNA, which may be the activating gene mechanism of activating gene sequences. 17bp and 29bp fragments are from SV40, but 17bp fragment has been found to exist generally in human and mouse genomes by blast software. Generally speaking, human and mouse cells impossibly provide especially regulatory elements for virus, it is sure that viruses utilize existed regulation mechanism in cells, so this study is helpful for the research of eukaryotic gene expression regulation, although the virus elements are used.Non-coding sequences have relation with many kinds of biology processes and human have payed attention to them gradually. In this study, we mutated 22R to study the role of DNA structure in activating gene expression. Besides, using the plasmids of different dosage containing different inserted fragments we commited transfection to study the change of GFP gene transfected ratio.Methods: 1 Synthesis of primers and DNA fragments as templatesPrimers with suitable restriction enzyme sites were designed and synthesized, and DNA fragments with different mutation sites were synthesized as templates. Primers used for construction of expression vectors and labeled probes in Northern hybridization are shown in tables of the first segment in this study.2 Construction of expression vectorsUsing primers with suitable restriction enzyme sites,the polymerase chain reaction (PCR) was used to amplify desired fragments, and then the PCR products digested with suitable restriction enzymes were inserted into downstream of GFP gene in pAlu14, so that expression vectors were obtained. If cohesive terminals of XbaⅠand NheⅠrestriction enzymes were ligated by T4 DNA ligase, neither XbaⅠnor NheⅠcould digest the site again. Using the characteristics, tandem expression vectors were obtained.3 Cell culture and cell transfectionHeLa cells were routinely cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum, and transfected with plasmid DNA via the liposome (Lipofectamine 2000; Invitrogen, Grand Island, NY) technique. Incubation was performed at 37℃, in 5% CO2 condition for 36h, in order to observe the expression of green fluorescence protein and to isolate total RNA for further study. 4 Northern blottingThe GFP probe was labeled withα-32P-deoxycytidine triphosphate (dCTP) via 9nt random primers. Total RNA from the plasmid-transfected HeLa cells was extracted with TRIzol reagent, The RNA was subjected to electrophoresis on a formaldehyde-denatured gel, transferred to nylon membranes. The nylon membranes containing RNA blots were treated with the GFP probe and autoradiography was performed, and then were treated twice with a solution of 50% formamide-5% SDS-50 mM Tris (pH 7.4) at 80℃for 1 hour and hybridized with aα-32P-labeled probe for neo (the cassette for neomycin resistance) RNA.5 RT-PCRTotal RNA was extracted from transfected HeLa cells using TRIzol Reagent. Reverse transcription was carried out using AMV reverse transcriptase (SBS, China) and a 9-nt random primer (SBS, China). the reaction condition: 50°C for 1h,85°C for 5min.The primers used for PCR were: forward, 1GFP1F: 5′-TGAGCCACCGCGCCCAGC-3′; and reverse, Alu1R: 5′-TGAGCCACCGCGCCCAGC-3′. The PCR reaction conditions were: 94°C for 30 sec, 50°C for 30 sec, and 72°C for 1 min for 30 cycles in 25-μl reaction buffers.6 Flow cytometry assayFlow cytometry assay was entrusted to the Fourth Hospital of Hebei Medical University.Results: 1 construction and assessment of recombination expression vectorsBecause this study wanted to introduce NheⅠenzyme cutting site into multiclone site (MCS), the NheⅠenzyme cutting site upstream GFP gene of pEGFP-C1 plasmid was removed. The above mentioned pEGFP-C1 was called"C1 removed Nhe". In this study, the plasmids used were all"C1 removed Nhe"pEGFP-C1 was inserted with Alu14 at MCS and inserted again the researched fragments between GFP an Alu tandem repeats to observe the relief of GFP gene induced by Alu tandem repeats. Recombination expression vectors were assessed by PCR, sequencing and enzyme cutting and the correct plasmids were used in this study.2 The effect of vesical base number on GFP gene expression22R could fold into the structure as Fig. 1(The first segment of this study, Fig.1), which includes a 3nt loop, two 3bp stem and 2nt vesic. In this study, in order to research furtherly the activating gene mechanism of 22R, we mutated the base number of stem-loop structure vesic from 2nt to 4nt and 6nt, then inserted the two tandem repeats of each mutated segment or wild type segment between GFP and Alu tandem repeats to construct expression vectors. The results showed that only when the vesical base number was 2nt and wild type, the sequence could activate gene significantly, while other base numbers of vesic couldn't (The first segment of this study, Fig. 2a, lane 2, 3 vs. lane 4).3 The effect of vesical base type on GFP gene expressionWe changed stem-loop structure vesical base type, then inserted the two tandem repeats of each mutated segment or wild type segment between GFP and Alu tandem repeats to construct expression vectors and carried out Northern blot. The results showed that only wild type and 4TMI could activate gene significantly (The first segment of this study, Fig. 3a, lane 1-5 vs. lane 6 and 7).4 The effect of stem base type on GFP gene expressionWe changed stem base type of stem-loop structure, then inserted the two tandem repeats of each mutated segment between GFP and Alu tandem repeats to construct expression vectors and carried out Northern blot. The results were in Fig. 4 (The first segment of this study). Among all the mutations, only 4TMI and 5AMI could activate gene, both of them were higher than 22R significantly. Northern results of 4T and 4TMI were verified by RT-PCR (Fig.4 e), which were coincidence with Northern results. 4T, 5A, 5AMI and 4TMI of Northern results were verified by flow cytometry assay and assessment of GFP protein fluorescence, which were coincidence with northern results (The first segment of this study, Fig. 4f, g).5 The results of MCF-7 cell In order to verified the activating gene function of 4TMI and 5AMI in other kind of cells, we replaced HeLa cells with MCF-7 cells in experiment, the results (The first segment of this study) showed 4TMI and 5AMI could activate gene, whch were higher than 22R significantly, none of other sequences could activate gene notably compared with pAlu14 (The first segment of this study, Fig.5, lane 3 and 4 vs. lane 6). These results were coincidence with Northern results.6 The effect of the complementarity of stem-loop structure on GFP gene expressionAccording to the above mentioned results, we presumed that the stem-loop structure was the basis of 22R to activate gene, the stem-loop structure couldn't excessively be complete and excessively be un-complete, ortherwise, it couldn't activate gene. We changed the 17 base of 22R into T (4T) whose stem-loop structure was completed fully and losed the vesic structure. We changed the 4 base to 10 base into T and 17 base into T(7pieT), changed the 14 base to 20 base into A(7pieA) whose stem-loop structure was fully un-complete. The two tandem repeats of each mutated segment were inserted between GFP and Alu tandem repeats to construct expression vectors and Northern blot was carried out. The results of Northern blot in Fig. 6 showed that 4T, 7pieT and 7pieA couldn't activate GFP gene notably (The first segment of this study, Fig. 6a lane 2, 4 and 5 vs. lane 6).7 RNA degradation experimentThis experiment was based on the amount of RNA which was influenced by the amounts of transcription and degradation. In order to eliminate the influence of RNA degradation velocity on the results of this experiment, we carried out RNA degradation experiment. The RNA in cells was inhibited to synthesize, the cells were cultured for different time and the RNA was extracted. The results showed that the degradation velocity of four plasmids (4T, 1AMI, 2AMI and 4TMI) were essentially same, which suggested that GFP gene in different plasmid expressed differently because of the different level of transcription. 8 The effect of 22R loop base mutation on GFP gene expressionHeLa cells was trypsinized, diluted to be 2×105/ml and added into 24 well cultured plate, 0.5ml/well, cultured for 24h under condition of 37℃, 5% CO2. The constructed plasmids inserted with loop mutated sequences (total 14 plasmids including 22R) were transfected, with the transfected amount of 0.4μg plasmid/2μl liposome every well. The cells were cultured for 36h after transfection and fixed for assessment ratios of fluorescence positive cells. The results were in table 3 (The second segment of this study). Loop base type mutation influenced on GFP gene expression significantly, AAG, AGA, TGT, TTG and TGC (22R, wild type) could activate gene expression notably (Table 3, marked with black). AAA activated gene most poorly.9 The effect of 22R vesic base mutation on GFP gene expressionWe found that the two plasmids, VECT and VEGT, could activate GFP gene expression which were the samed as 22R (VEAA, wild type). The ratios of fluorescence positive cells of the two plasmids were 2.70% and 1.73% respectively (table 3). Importantly, we found that four plasmids, VETA, VETC, VETG and VETT, could activate gene expression more significantly. The ratios of fluorescence positive cells of the four plasmids were 5.60%, 2.96%, 12.76% and 20.34% respectively (table 4). These plasmids, which could activate gene expression significantly, had a common characteristic, namely, they all contained"AAATAAA"sequence. What is the important role of these sequences in GFP gene activation? We constructed AA, TT, 7A and 7T sequences and inserted the mutated sequences between GFP and Alu tandem repeats in C1-Alu14. The results showed that AA sequence(GTGAAATAAATGCAAATAAAGT)could activate gene significantly (table 4, number 17), but less than VETT (4TMI) sequence (GTGAAATAAATGCTTTTTTTGT, table 4, number 16) which showed that when AAATAAA matched other sequence (TTTTTTT), it could activate gene more notably.10 The effect of different concentration of cells on GFP gene expression The cells were transfected and cultured for 24h or 36h, RNA were extracted for Northern blot the results of which were in Fig.1 (The third fragment of this study). 1A, 22R and Alu14 were transfected with different concentration of cells and the transfected cells were cultured for 24h. Northern blot showed that the transfected efficiency of 2.0×105/ml of cell concentration was high than that of 1.0×105/ml of cell concentration (The third fragment of this study,Fig.1 lane 1 vs. lane 2, lane 3 vs. lane 4, lane 5 vs. lane 6). The results of culture time of 36h were similar to those of 24h of culture time(Fig.1, lane 7 vs. lane 8, lane 11 vs. lane 12, lane 15 vs. lane 16). 1AMI and 4TMI were transfected with different concentration of cells, then the transfected cells were cultured for 24h. The results showed that the transfected efficiency of 2.0×105/ml of cell concentration was high than that of 1.0×105/ml of cell concentration (Fig.1, lane 9 vs. lane 10, lane 13 vs. lane 14).11 The effect of transfected amount of different plasmids on GFP gene expressionC1-ORF2 with transfected amount of 0.8μg acitivated GFP more than that with transfected amount of 1.2μg (The third segment, Fig.3), and this phenomenon was less evident in other plasmids than C1-ORF2. In order to validate this, we again commited the similar experiment with C1-ORF2,C1-ORF2as and C1-Alu14, the results of which showed that C1-ORF2 and C1-ORF2as were not similar to C1-Alu14 (the third segment, Fig.4A, lane1-6 vs. lane 7-9). The GFP gene expression of C1-Alu14 increased with increase of transfection amount, while that of C1-ORF2 and C1-ORF2as increased less or a little decrease in transfected amount of 1.2μg. In Fig.4B, C1-Alu14as, C1-280-1*14 and C1-280-1*14as were used in experiment, the results of which showed that C1-280-1*14 and C1-280-1*14as with transfected amount of 0.8μg acitivated GFP more than that with transfected amount of 0.4μg , but C1-280-1*14 and C1-280-1*14as with transfected amount of 1.2μg acitivated GFP less more or less than those with transfected amount of 0.8μg (The third segment, Fig.4B, lane 4-9), GFP gene expression of C1-Alu14 increased with the increase of transfected amount, which was similar to Fig.4A.Conclusion: 1 There is obviousble effect of activating GFP gene when base number of bubble is 2nt in stem-loop structure of 22R. Effect of activating GFP gene will decrease when increasing or decreasing the base number of bubble.2 Changing the base type of 22R stem, only 4TMI and 5AMI activates GFP gene expression.3 The excessively complete and excessively un-complete stem-loop can not activate GFP gene. VEAT (4T) sequence is excessively complete, 7pieA and 7pieT sequences are fully un-complete, and neither of them activate GFP gene expression.4 The sequences of VETA, VETC, VETG and VETT enhance GFP gene expression, AA (GTGAAATAAATGCAAATAAAGT) can activate gene, which illustrates that AAATAAA plays an important role in activating gene, but the effect of VETT (GTGAAATAAATGCTTTTTTTGT) activating gene is higher than that of AA sequences, which illustrates that AAATAAA cooperates with other sequence to educe maximal effect of activating gene.5 Base type of loop significantly affects GFP gene expression. The five plasmids, AAG, AGA, TGT, TTG and TGC (22R, wild), can activate gene expression significantly, AAA activated gene expression most poorly.6 The type and amount of transfected plasmids and the concentration of transfected cells influenced the expression of transfected plasmids.
Keywords/Search Tags:SV40PolyA, Stem-loop, complementarity, GFP, transfection
Related items