| The D cell of gastrointestinal tract can secrete somatostatin (SST). It is a small cyclic peptide in two biological active forms: SST-14, consisting of 14 amino acids and SST -28, consisting 28 amino acids. SST is formed by proteolytic processing of larger precursor molecules: prepro-SST and pre-SST. SST inhibits pancreatic enzyme secretion and bile secretion. It also inhibits the secretion of secretin, insulin, glucagons and vasoactive intestinal peptide. In addition to playing an important role in neurotransmission and secretion, SST may control cell proliferation in normal tissues and tumors.SSTR consists of five subtypes named as SSTR1, SSTR2, SSTR3, SSTR4 and SSTR5 respectively, and it belongs to the superfamily of G protein-coupled receptor (GPCR). SST mediates its actions by interacting with a family of somatostatin receptors (SSTR) and activates downstream signal transduction pathways.Akt, a serine/threonine kinase, coded by akt1 and akt2 genes, is highly homologous to virus oncogene v-akt. Since its homologus with PKA and PKC, Akt also be named PKB. Akt has emerged as a central player in the signal transduction pathways activated in response to growth factors and is thought to contribute to several cellular function including cell growth, transcription regulation and nutrient metabolism. Blocking of Akt signaling pathway can induce apoptosis and growth inhibition of cancer cells. SST analogues can inhibit Akt activity, and induce apoptosis and growth inhibition of gastric cancer cell. Few studies on transcriptional factors and target genes mediating SST anti-proliferative action have been found. ZAC (zinc finger protein which regulates apoptosis and cell cycle arrest) is a zinc finger transcriptional factor that reveals transactivation and DNA-binding activity. ZAC inhibits tumor cell growth through induction of apoptotic cell death and G1 arrest. In 2006, Theodoropoulou reported that a somatastatin analogue, octreotide (OCT), mediated its antiproliferative action in pituitary tumor cells by inducing ZAC expression via Akt pathway.In gastric cancer cells, whether SST mediates its antiproliferative action by Akt signaling pathway and inducing ZAC expression has not been reported. In this study, expression spectrum of SSTR subtypes in gastric cancer cell lines was demonstrated by RT-PCR, and supplies the data for selecting proper SST analogue in next experiment. After treatment by SST analogue OCT, the level of Akt, phosphorylated Akt (p- Akt) and ZAC in gastric cancer cells was detected by Western blot, and explore the mechanism of SST mediating its antiproliferation.Materials and methods1. Materials BGC-823 and SGC-7901human gastric cancer cell lines were cultured in RPMI - 1640 supplemented with 10% heat-inactivated FBS, 100KU/L penicillinand 100KU/L streptomycin, in a 37℃, 5 % CO2 incubator. Total RNA was extracted and used in RT-PCR to detect expression of SSTR mRNA expression.2. RT-PCR Primer SSTR1: sense, AGCCGGTTGACTATTACGCC, antisense, GCTCTCACTTCTACCATTGTC;SSTR2:sense,GGTGAAGTCCTCTGGAATC C,antisense,CCATTGCCAGTAGACAGAGC;SSTR3:sense,TCATCTGCCTCT GCTACCTG, antisense, GAGCCCAAAGAAGGCAGGCT; SSTR4: sense, CGGCAGTCTTCGTGGTCTAC, antisense, GCATCAAGGCTG GTCACGAC; SSTR5:sense,AACACGCTGGTCATCTACGTGGT,antisense,AGACACTGGT GAACTGGTTGAC; p-actin: sense, TCCTGTGGCATCCACGAAACT,antisense, GAAGCATTTGCGGTGGACGAT. 94℃30 s; 60℃, 1min; 68℃,2min; 40 cycles.68℃, 7 min; 4℃, 0s. Amplified products were run on 1.5% agarose gel to demonstrate results.3. MTT The gastric cancer cell lines BGC-823 and SGC-7901 were treated with OCT at 1 nmol/L, 10 nmol/L, 100 nmol/L and 1000 nmol/L final concentration for 24h, respectively. MTT was used to demonstrate inhibitory effect of OCT on proliferation of gastric cancer cells and to screen the effective concentration.4. The gastric cancer cells were treated with OCT at effective concentration for 24h. Total cellular proteins were extracted and used in Western blot for Akt and p-Akt detection. The nuclear proteins were extracted and used in Western blot to detect ZAC expression.5. Western blot The chemical luminescence method was used to demonstrate signals of Western blot,β-actin was used as internal control.6. Statistical analysis The data were analyzed by SPSS10.0 statistical software, and P<0.05 was used as test level.Results1. RT-PCR showed that the length of amplified fragments of SSTR1 to SSTR5 was 334bp, 461bp, 221bp, 247bp and 211bp respectively, and that ofβ-actin was 385bp. The SSST1, SSTR2, SSTR4 and SSTR5 mRNAs were detected in both BGC-823 and SGC-7901 human gastric cancer cell lines. However, SSTR3 mRNA was not detected in both of cell lines.2. The results of MTT showed that the inhibitory rates of 10 nmol/L OCT treatment on proliferation of gastric cancer cell lines BGC-823 and SGC-7901 were23.98% and 52.96%, which was similar to the effect of 100 nmol/L OCT of 19. 41 %and 46.93 %. 10 nmol/L OCT was used as effective concentration.3. The results of Western blot showed that, after 10nmol/L OCT treatment for 24 h, Akt level did not exhibit obvious change; p-Akt level was down-regulated significantly; however, ZAC level was up-regulated significantly.Conclusion1. SSTR3 mRNA is not deleted in both gastric cancer cell lines BGC-823 and SGC-7901. 2. In gastric cancer cell lines BGC-823 and SGC-7901, OCT treatment may inhibit phosphorylation of Akt and induce ZAC expression. |