| Hereditary gingival fibromatosis (HGF) is a rare oral condition characterized by a slow, progressive enlargement of the gingival. HGF may manifest as an isolated finding or in associated with other features, as part of a syndrome. In most of the cases, HGF is identified as an autosomal-dominant condition although recessive forms are described in the literature. Conventional gingivectomy is mainly treatment available. However, recurrence is a common feature. Recently with the driving of genome project and the development of molecular genetics, many research workers pay their attention to identify the gene responsible for HGF, and have made a series of progress. However, because of heterogeneity in gene, clinical manifestation, histomorphometric characteristics, the cause and pathogenesis of HGF are constantly an outstanding question. In 2002, Hart presented evidence that a single-nucleotide-insertion mutation in codon 1083 of the SOS1 gene, exon 21 is the cause of HGF in a large Brazilian family. So we put forward a doubt that is whether this mutation is the cause of HGF in our country. We study 2 families with HGF to verify it. The method as follow: [1] collection of blood samples Peripheral venous blood ( 5 ml ) was obtained by standard venepuncture from members of 2 families ( family 1 , total 11 people,6 people with gingival fibromatosis , 5 people without gingival fibromatosis ; family 2 , total 11 people,5 people with gingival fibromatosis , 6 people without gingival fibromatosis ). At the same time, Peripheral venous blood (5 ml) was obtained by same method from 11 normal people. [2] extraction of genomic DNA Genomic DNA was extracted using Phenol-Chloroform-Isoamyl alcohol, after digestion with Protease K, and was dissolved with TE solution. It was saved at -20℃after detection with 1% agarose gel electrophoresis. [3] polymerase chain reaction (PCR) primer 1: 5′—3′AGGGCTTTAGCAAAATAGAATGTT primer 2: 3′—5′ACTTGCAGATTTTAAGACTGATCT reaction mixture: template DNA 0.5μg, primer 1 37.5pmol, primer 2 37.5pmol, TaqDNA polymerase 2.5U, 10mMdNTP mixture 1μl, buffer(without Mg2+) 5μl, Mg2+ 3.0mM, ddH2O 32.5μl. reaction condition : 94℃5′;94℃30′′, 50℃30′′, 72℃1′,30 cycles , 72℃10′( final extending ). PCR products were detected with 0.8% agarose gel electrophoresis. [4] single strand conformation polymorphism (SSCP) and staining After cut of restriction endonuclease and degeneration ,the PCR products were examined by SSCP. Finally, the gel was stained and recorded. The results as follows: [1] result of PCR Agrose gel electrophoresis of all PCR products ( 2 families ) showed one clear line which meant that the longth of DNA was 750pb,so we can say there was no deletion or insertion in PCR products. [2] result of SSCP PCR-SSCP showed no abnormality among family members without HGF systems. However , among family members with typical HGF symptoms, there were 6 patients ( family 1, 4patients; family 2, 2 patients ) whose electrophoresis patten were abnormal .In addition ,their abnormalities were not absolutely identical . Electrophoresis patten of family 1 were more close than those of normal group, but those of family 2 were further .So we can draw conclusions . [1] SOS1 gene is one related gene of HGF in our country. [2] There was mutation of SOS1 gene, exon 21, among members of 2 families with typical HGF symptoms. But maybe there is difference between 2 families. [3] Members of 2 families with typical HGF symptoms have not all mutation of SOS1 gene. There is maybe another mutation or minor gene and it is not eliminated that HGF is polygenic disease. [4] In one family, the mutation is maybe different among different members. Now, there are more question that need us solve. We have confirm mutation of SOS1 gene, exon 21, in our country, but we do not know where or which base mutation is, and whether there is mutation of another gene or there are some mutations at the same time. In addition, it is not clear-cut that the regulation and control of HGF related gene expression, interaction between genes and the structure and function of corresponding protein. Finally, we should research the methods of gene diagnosis and gene therapy. The topic has some clinical significance. HGF is a rare disease and do not endanger the lives of patients. Incidence rate is only 1/175000 in foreign country, but that is perhaps higher in China. Moreover, members in family have same opportunities with HGF, and treatment is not available. Today, with the development of medical science, medical mode has been changed, so we must diagnose and cure disease more quickly... |