| Objective: Plant external vesicles are small nanoscale vesicles secreted by plant cells containing DNA,small RNA and proteins that mediate intercellular communication and enable regulation of cross-border gene expression.Liver cancer is one of the common malignant tumors in China,and the existing treatments for liver cancer have many side effects and poor results.In this study,we determined the extraction method of ginseng root external vesicles,identified and characterized them,and investigated the anti-tumor activity of ginseng root external vesicles to provide new ideas and methods for the study of plant external vesicles.Methods:(1)The morphology and particle size of ginseng root external vesicles were identified by transmission electron microscopy and NTA particle size analysis,and the protein concentration in ginseng root external vesicles was measured by Bradford method.Protein species in ginseng root external vesicles were detected by proteomics,and small RNA species and content in ginseng root external vesicles were detected by small RNA sequencing.(2)The cells were screened by CCK8 method,and the effects of ginseng root external vesicles on apoptosis and proliferation of hepatocellular carcinoma cells were examined by Hoechst staining,JC-1 staining,flow cytometry and Western Blot;the migration and invasion of hepatocellular carcinoma cells were examined by scratch assay and transwell assay.The tumor suppressive effect of ginseng root external vesicles was verified in vivo by fluorescence uptake and change in seed tumor volume.(3)Screening of mi RNAs in ginseng root external vesicles by flow cytometry;screening of mi R-2118 target genes against hepatocellular carcinoma in ginseng root external vesicles using three major databases,Gene Cards,mi RDB,and THE HUMAN PROTEIN ATLAS;using immunofluorescence,q RT-PCR,Western Blot,and circular dichroism The anti-tumor mechanism of mi R-2118 was investigated.Results:(1)Natural ginseng external vesicles were successfully extracted from ginseng root external vesicles,which were identified as external vesicles with high purity by transmission electron microscopy and NTA particle size detection,and the external vesicles showed a bilayer membrane teatroid structure with particle size in the range of 105.3 nm accounting for 96.7%.2.9 mg/kg of ginseng root exosome protein concentration was determined by Bradford method.Natural ginseng external vesicles were successfully extracted from the root skin of ginseng.Transmission electron microscopy showed that the outer vesicles had a double-layer membrane structure,and the particle size of the outer vesicles was 105.3nm,accounting for 96.7%.(2)The most sensitive cells after ginseng root exosome administration were hepatocellular carcinoma BEL-7402 cells,and in vitro experiments showed that ginseng root exosome could promote apoptosis,inhibit proliferation,migration and invasion of hepatocellular carcinoma cells.In vitro experiments showed that ginseng root external vesicles could promote apoptosis,inhibit proliferation,migration and invasion of liver cancer cells.Western Blot showed that ginseng root external vesicles increased the expression of Bax and Cyt C proteins and decreased the expression of Caspase3 and Bcl2 proteins in both BEL-7402 and HCCLM3 cells.The results of in vivo experiments showed that ginseng root external vesicles could significantly inhibit tumor growth in vivo.(3)A total of 16,804 disease targets were searched in the Gene Cards database by searching the entry of "liver cancer".The 5’-3’ sequence of mi R-2118,TTTCCTATTCCACCCATCCCAT,was searched in the mi RDB website to obtain a total of902 target genes,and 98 genes with a Target score ≥ 90 were obtained.The genes obtained from the two databases were intersected and a total of four genes were intersected,namely TET2,TGFBR1,TGFBR2,and JAK2.The expression of the four proteins in normal hepatocytes and hepatocellular carcinoma cells was verified by THE HUMAN PROTEIN ATLAS website.The results of the database showed that both RNA and protein of TET2 were expressed in normal liver organs with a certain amount of RNA and protein,and the expression was higher compared to other organs.Western Blot and immunofluorescence results showed that the expression of TET2 protein was higher in LO2 normal hepatocytes than in BEL-7402 hepatocellular carcinoma cells.to be sequentially oxidized to 5-hydroxymethylcytosine(5hm C),which ultimately leads to the occurrence of DNA hydroxymethylation,in contrast,5hmc levels were significantly lower and 5mc levels were significantly higher in hepatocellular carcinoma cells BEL-7402,which correlated with the decrease of TET2 protein in hepatocellular carcinoma cells.western blot examined the exosome administration of ginseng root and mi R-2118 transfection of hepatocellular carcinoma cells The expression levels of TET2 after BEL-7402 and HCCLM3 transfection were detected by western blot.The expression of TET2 increased after ginseng root exosome treatment and mi R-2118 transfection compared with the control group and the expression of TET2 increased with increasing dose of exosome administration.Immunofluorescence results showed that the fluorescence of TET2 was enhanced after ginseng root exosome administration and the conversion of 5mc to 5hmc from methylation to hydroxymethylation.Similarly,the expression of TET2 after mi R-2118 transfection showed the same upward trend with enhanced fluorescence and conversion of 5mc to 5hmc with enhanced fluorescence of5 hmc.This result was consistent with the Western Blot results.We performed validation in that the circular dichroism results showed that the promoter region of TET2 gene selected two G-base-rich sequences TET2-1 and TET2-2 to form two G-quadruplexes,exhibiting a typical CD antiparallel structure with positive peak at 295 nm and negative peak at 265 nm.mi RNA-2118 was made to bind to TET2-1,TET2-at a 1:1 ratio.The CD spectra of TET2-1 and TET2-2 were parallel G-quadruplex peaks with positive peak at 260 nm and negative peak at 240 nm.therefore,we speculate that mi RNA binding to the 5’ end base of TET2 to make its Grich base can better form the G-tetraspanic structure.Conclusion:(1)External vesicles were successfully extracted from fresh ginseng roots using a combination of differential centrifugation and density gradient centrifugation,and were identified as external vesicles by transmission electron microscopy and NTA particle size detection,while external vesicles from different parts of ginseng roots were extracted.In this chapter,the distribution of ginseng root external vesicles from different parts was examined for the first time,and the types of proteins and mi RNAs in ginseng root external vesicles were identified to provide a reference for the study of ginseng root external vesicles.(2)Ginseng root external vesicles have good anti-cancer activity,which was determined by screening four cell lines of human lung,liver,colon and gastric cancers,and its strong antiliver cancer activity was determined.The anti-tumor effect of ginseng root external vesicles was further verified by in vivo and ex vivo experiments,which laid the foundation for the next in-depth exploration of the anti-liver cancer mechanism of ginseng root external vesicles.(3)The anti-tumor mechanism of ginseng root external vesicles was further clarified by screening nine mi RNAs from ginseng root external vesicles.We confirmed that ginseng root exosome-derived mi R-2118 can affect biological processes such as cell growth and metastasis.mi R-2118 was associated with liver cancer targets using three databases,Gene Cards,mi RDB,and THE HUMAN PROTEIN ATLAS,and the target genes were screened and validated.This process confirmed that ginseng root external vesicles and their source of mi R-2118 were able to increase the expression of TET2 gene,promote the conversion of 5mc to 5hmc and undergo DNA hydroxymethylation in hepatocellular carcinoma cell species.Also circular dichroism data showed that mi R-2118 could enhance the G-quadruplex of TET2,which in turn promoted the transcription of TET2.These data suggest that TET2 plays a key role in the development of hepatocellular carcinoma and represents a new therapeutic biomarker,laying the foundation for further tumor treatment and drug development. |
PDF Full Text Request