| Colorectal cancer is one of the most common malignant tumors in human beings.Surgical treatment is still the main treatment at present.However,nearly half of colorectal cancer patients have micrometastasis before radical surgery,which is undoubtedly the direct cause of postoperative metastasis and recurrence of colorectal cancer patients.HOXB7,a homeobox gene located on chromosome 17q21.3,contains a highly conserved homeobox sequence composed of 183 nucleotides.It encodes a protein with a homeobox DNA binding domain,which has different levels of expression in various tissues and organs of human body and mammals.In this study,we detected the expression of HOXB7 protein in normal colon and colorectal cancer,then the expression of HOXB7 m RNA in six colon cancer cell lines.RNA interference technology was used to inhibit or enhance the expression of HOXB7 in colon cancer cell lines HCT116,Caco-2、SW620 and Lo Vo.The effect of HOXB7 gene on the proliferation,migration and invasion of colon cancer cells in vitro was detected by plate cell cloning,MTT,cell cycle and apoptosis,Transwell migration,and invasion experiment based on Matrigel.The effect of HOXB7 gene on the migration and invasion of colon cancer cells in nude mice was further observed in the model of subcutaneous planting and tail vein injection.This study consists of three parts:(1)the expression of HOXB7 protein in human colorectal cancer;(2)the effect of HOXB7 on the proliferation and apoptosis of human colon cancer cells;(3)the effect of HOXB7 on the invasion and metastasis of human colon cancer cells.Part I Expression of HOXB7 in human colorectal cancer tissuesObjective To detect the expression of HOXB7 protein in normal colon and colorectal cancer tissues,analyze the clinicopathological characteristics,and explore the significance of its expression level in human colorectal cancer.Methods(1)327 cases of colorectal cancer tissues were collected and made into tissue chips.Detect the expression of HOXB7 protein by immunohistochemistry(IHC)and analyze the correlation between HOXB7 protein and the clinicopathological features of colorectal cancer,such as p TNM staging,pathological grade,lymph node metastasis,vascular invasion.(2)Western blot was used to detect the expression of HOXB7 protein in fresh tissues of colorectal cancer,adjacent tissues and normal colonic mucosa.Results(1)In 327 cases of colorectal cancer and 24 cases of normal tissue,70.03%(229/327)of colorectal cancer showed high expression of HOXB7.(2)The expression level of HOXB7 significantly correlated with tumor differentiation(P=0.000),tumor invasion vessel(P=0.004),lymph node metastasis(P=0.001),distant metastasis(P=0.005),p TNM staging(P=0.002).(3)Western blot showed that the expression of HOXB7 in fresh human colon cancer tissues was significantly higher than that in normal intestinal mucosa tissues.Conclusion Compared with normal colon tissue,the expression of HOXB7 protein in human colon cancer is abnormally high,and has significant correlation with tumor differentiation,tumor invasion of vessels,lymph node metastasis,distant tumor metastasis,and p TNM staging.Part Ⅱ The effect of HOXB7 on proliferation and apoptosis of human coloncancer cellsObjective To investigate the effect of HOXB7 on the proliferation and apoptosis of human colon cancer cells.Methods(1)The expression of endogenous HOXB7 in six human colon cancer cell lines was detected by real-time quantitative PCR and Western blot.(2)pc DNA3.1-HOXB7 and HOXB7 sh RNA recombinant plasmids were constructed and transiently transfected with HCT116,Caco-2,SW620 and Lo Vo cells respectively.Each was divided into two groups: empty plasmid transfection group and objective gene transfection group.The transfection efficiency was detected and the effective plasmids were screened.(3)Changes in cell plate clone formation,MTT cell viability,cell cycle,and apoptosis in each group of cells were measured.Results(1)Among the six human colon cancer cells,the expression level of endogenous HOXB7 m RNA and protein is the highest in Caco-2 cells,and is middle level in HCT116 and SW620 cells,while the lowest in Lo Vo cells.(2)Effective sh RNA plasmids were selected from Caco-2,HCT116 and SW620 cells.Compared with the same group of cells transfected with empty plasmid,sh RNA HOXB7 plasmid(sequence GCCTCACGGAAAGACAGATCA)effectively inhibited the expression of HOXB7 m RNA in Caco-2,HCT116 and SW620 cells,while pc DNA3.1-HOXB7 plasmid effectively enhanced the expression of HOXB7 m RNA in Lo Vo and HCT116 cells.(3)Compared with the control group,there was no significant difference in cell plate clone formation and the activity of MTT cells in all objective gene transfection group.(5)The cell cycle of Caco-2/sh RNA,SW620/sh RNA,HCT116/sh RNA,Lo Vo/HOXB7 and HCT116/HOXB7 were detected by flow cytometry.It was found that the proportion of cells in S phase and M phase did not change significantly,and there was no significant difference in cell proliferation.(6)The apoptosis level of Caco-2,HCT116 and SW620 cells transfected with HOXB7 sh RNA plasmid was higher than that of the control group,but the expression level of HOXB7 gene in Lo Vo and HCT116 cells increased exogenous,which could not inhibit the apoptosis.Conclusion The expression of HOXB7 gene in human colon cancer cell lines increased in varying degrees.HOXB7 sh RNA can effectively inhibit the expression of HOXB7 m RNA in colon cancer cells.Increasing or decreasing the expression level of HOXB7 cannot significantly affect the proliferation of Caco-2,HCT116,SW620 cells.Silencing the expression of HOXB7 can promote the apoptosis of Caco-2,HCT116,SW620 cells,but the exogenous increase of HOXB7 expression could not inhibit the apoptosis of colon cancer cells.Part Ⅲ The effect of HOXB7 on invasion and metastasis of human colon cancer cellsObjective To investigate the effect of HOXB7 gene on the invasion and metastasis of human colon cancer cells.Methods(1)pc DNA3.1-HOXB7 and HOXB7 sh RNA recombinant plasmids were transfected into HCT116,Caco-2,SW620 and Lo Vo cells.Each group was divided into two groups: empty plasmid transfection group and target gene transfection group(the same as Part Ⅱ).Transwell Migration Experiment and invasion experiment based on Matrigel were observed.(2)HCT116/Scramble and HCT116/sh RNA cells were injected subcutaneously and in the tail vein of nude mice respectively to observe subcutaneous tumorigenesis and tumor metastasis.Results(1)Decreasing the expression of HOXB7 gene level has a significant inhibitory effect on the migration and invasion ability of HCT116,Caco-2,and SW620 cells,while enhancing the expression of HOXB7 gene level promotes the migration and invasion of Lo Vo and HCT116 cells.(2)Silencing HOXB7 gene expression can inhibit the growth of subcutaneous tumor in nude mice and reduce the incidence of tumor metastasis.Conclusion Silencing the expression of HOXB7 gene can inhibit the migration and invasion ability of Caco-2,HCT116 and SW620 cells,while increasing the expression of HOXB7 gene can promote the migration and invasion of Lo Vo 、 HCT116 cells.Subcutaneous tumor formation and tail vein injection tumor metastasis model in nude mice further showed that the expression level of HOXB7 gene can affect the invasion and metastasis ability of colon cancer cells. |
PDF Full Text Request