| Cadmium is a non-essential micronutrient with strong phytotoxicity to plants when it is absorbed through the root system and accumulated in the plant tissues. Sulfate metabolism,oxidation resistance systems and trans-membrane transport of cadmium are the main channels of plants response to cadmium,including cadmium-induced generation of sulfur transporters,sulfur reductase,cysteine, glutathione,phytochelatins,and gene expression and regulation.To study the mechanisms of cadmium tolerance and the gene expression in plants is important for improving the plants tolerance to cadmium and enabling a series of hyperaccumulation in plants in the future.In the paper,Cd tolerant alfalfa varieties in were selected among 36 alfalfa germplasms using hrdroponics system,then cadmium-induced oxidation resistance and photosythentic responses were analyzed in cd tolerant varieties Ye(Y) and Longzhong(LZ),and alfalfa metallothionein gene MsMT2a and MsMT2b were cloned using mRNA differential display method.The relults were shown as below:1) An appropriate Cd concentration used to screen alfalfa accessions for Cd tolerance was 25 mg/L CdCl2,which was selected on the basis of the Cd response in 50 randomly chosen alfalfa seedlings treated with 0,5,10,15,20,25,50 and 100 mg/L CdCl2,respectively.The four parameters,root length,shoot length,root weight and shoot weight,were measured in alfalfa plants under 25 mg/L CdCl2 treatment and control conditions respectively,and the results showed that the relative growth of root was the suitable parameter to measure the Cd tolerance in alfalfa.Two Cd-tolerance varieties,Y and LZ,were selected based on the Paired-Samples Tukey tests.2) The accumulation of cadmium and the changes of anti-oxidant enzymes and photosynthetic in Cd tolerant alfalfa varieties Y and LZ under under 25 mg/L CdCl2 treatment and control conditions were measured There were 1140 and 1122 mg kg-1 Cd in roots in Y and LZ after 8d CdCl2 treatment,respectively,while 94.8 and 89.5 mg kg-1 in shoots and 85.7 and 75.7 mg kg-1 in leaves were measured in Y and LZ respectively.The results above indicated that Cd accumulations in Cd tolerant alfalfa varieties Y and LZ were mainly in roots,and only few of the Cd transported into shoots and leaves.The weak transportation of Cd in Y and LZ may possibly avoid the phytotoxicity to photosynthetic system to show the Cd tolerance.The different trends were observed in SOD,POD and CAT activities under CdCl2 treatment(25 mg/L).In the first 12h under CdCl2 stress,POD activity was raised rapidly and then declined;while in the first 12h under CdCl2 stress,CAT activity was dropped first,and it was raised rapidly between 12h and 25h,and then declined regularly.The SOD activity had the same trend with that of CAT.The results indicated that at the beginning under CdCl2 stress,the activities of anti-oxidant enzymes were stimulated to improve the tolerance ability to Cd.The possible explaination of the decline of the activities of anti-oxidant enzymes then was due to the destruction of the the enzymes caused by heavy metal.The same changes of the Fv/Fm in the fifth leaf of Y and LZ were observed,that is the values the Fv/Fm were all declined as the time of treatment increased.The Fv/Fm declined about 1.3,3.5 and 4%compared to the values of CK at 6,12,24 and 48h in the treatments,respectively.There was no significant difference between treatment and control in the value of Fv/Fm,which indicated that Cd stress had little effects on the photosynthetic system in Y and LZ.3) The metallothionein genes of alfalfa were cloned using mRNA differential display method in Cd tolerant varietied Y and LZ.The specific primers of metallothionein genes AsMT2a and AsMT2b in plant were used (5'CATAATGAAATGAAACTA3' and 5'CGGGGACAGATCATCA3';5'AATAA ACTAGCTGGAGTCTTTCTTC3' and 5'ACGCGGGGACATCATCCATCTTC3'), and five PCR target bands in Y and LZ were obtained under Cd stress and control conditions.The metallothionein gene MsMT2a target bands(M1-M4) were 525bp and MsMT2b target band(M5) was 510bp.The results of homologous blast on NCBI showed that M1-M4 had high homologous with the metallothionein genes in Allium sativum with about 97-98%,and they also had homologous with Vigna angularis, Pisum sativum and Trifolium repens between 68-71%.The results of M5 showed that it also had high homologous with metallothionein genes in Allium sativum with about 98%,and it also had homologous with Pisum sativum and Vicia faba between 68-85%. The high homologous between M1-M5 and other plants such as Solanum tuberosum, Eichhornia crassipes,Thlaspi caerulescens,Nicotiana tabacum,Brassica juncea, Salvia miltiorrhiza and Lycopersicon esculentum were also existed. |