| Trichinella spiralis is one of the main parasitic pathogen in China. Screening of antigens with high specificity and immunity is one of the important ways for its prevention and detection. In Trichinella life cycles newborn larval (NBL) is the only nonintracellular stage living free in the host and with the highest protective immunity. The stage specific gene of NBL probably plays an important role in immunity.In this study, the NBL stage specific cDNA fragment T68 was prepared from NBL substration cDNA library and identified by southern blot hybridization with radioactive ci ..32p labeling.The results suggested the probe show a high specificity with Trichinellosis spiralis newborn larva, and there was no cross-reaction with related eDNA from Adult and Muscle Larvae. Based on the stage specific probe T68 labeled with digoxingenin- 11 -dUTP (DIG), the cDNA library of Trichinellosis spiralis newborn larva of Chinese isolates Tspiralis was screened by twice plaque hybridizations. The full length eDNA of Tag(SSC2) was firstly obtained. Sequencing result revealed that it was 1609bp in length and contained the full length of an open reading frame of 1395 nucleotides. Using the software of ANTHEPROT 4.3,the secondary structure of the deduced aminoacid sequences of SSC2,hydrophobicity and isoelectric point has been predicated.The results suggested it is a polypeptide of 465 amino acids with a molecular weight of 50.lkDa and a isoelectric point of 9.775. Search results of NCBI BLASTp and PROS ITE database suggested it can be classified as trypsin family serine protease,and there is a high Antigencity active region between 190-460 aminoacids. Based on the analytic results of ANTLIEPROT 4.3 and the open reading frame of full length SSC2, one strain of PBK-CMV-SSC2 recombinants phagemid contained the Antigencity active fragments of SSC2 was infected into expression host bacteria XLOLR. After incubated with 0.Smmol/L and lrnmol/L IPTG, more than 20% percentage of extraneous protein was detected using SDS-PAGE.Based on the open reading frame of full length SSCI which has been identified as NBL stage-specific gene coding an glycoprotein,the forward PCR primer (AGGTCGACGTTGCAACATGCAAAAACG )with a Sal I enzyme site39has been designed using the software DNAsis. Using the forward primer and T7 primer, the full length gene of SSC1 was amplified. After cloned in pMD18 I Vector and digested with the enzyme Sal I and Xho I,and digested pET28b with Sal I, Xho I and ClAP, the stage specific gene SSCI was recombined with the T7 promoter-driven expression vector pET28b.The identified with Enzyme digested and sequenced results consistent with designed, suggested it can be used as express vector. |