| Sperm exhibit sensitivity to changes in environmental factors.Ion channels are key proteins responding to external stimuli and playing critical roles in sperm function regulation.However,in contrast to the intense studies of ion channels in mammalian and marine invertebrate(such as sea urchins)sperm,the identification of functional ion channels in fish sperm is very limited.This study showed that zebrafish sperm motility could be suppressed by general calcium channel blockers rather than by general potassium channel blockers.Further investigation found that sperm motility was not only suppressed by ruthenium red,one kind of antagonist for the transient receptor potential vanilloid channel,subtype 1(Trpv1),but also restored by Trpv1 channel agonist 2-APB,suggesting the presence of functional Trpv1 channel in zebrafish spermatozoa.Western blot and immunofluorescence analysis proved the expression of Trpv1 channel which was mainly distributed in the neck and tail regions of zebrafish sperm.Furthermore,in vitro fertilization results showed that the suppression of sperm motility by Trpv1 channel antagonist could reduce fertilization rate.In this study,since the non-specific antagonist or agonist of Trpv1 channel was used in the pharmacological experiments,it was hoped that the above results could be further validated by constructing trpv1-/-homozygous zebrafish model in order to verify the reliability of the above results.The sequence GGCGGTGGATGTCAGGGAGA in exon 5 of zebrafish trpv1 gene was selected as knockout target and trpv1+/-zebrafish model was successfully constructed by using Crispr/cas9 technology.17 trpv1-/-zebrafish homozygotes(6 males and 11 females)were screened from 431 offspring of trpv1+/-zebrafish mating.Western blot and immunofluorescence results showed that the expression of Trpv1 channel was absent in trpv1-/-zebrafish sperm,while pharmacological experiments also showed that the antagonist and agonist of Trpv1 channel had no significant inhibition or activation effect on the motility of trpv1-/-zebrafish sperm,as well as treatment with ruthenium red had no significant effect on the fertilization rate,either.The above results confirm that Trpv1 channel indeed regulates zebrafish sperm motility after its activation.In conclusion,this study confirmed that the activity of Trpv1 channel plays an important role in the maintenance of motility after zebrafish sperm activation by using the screened trpv1-/-zebrafish model.Suppression of Trpv1 channel activity will also affect the fertilization ability of zebrafish sperm.This is one of the limited studies showing the importance of ion channels in regulating zebrafish sperm function,and may enrich our understanding on male reproductive physiology of zebrafish and offer novel regulatory target for freshwater fish breeding and sperm cryopreservation. |