Mechanisms Of BRD2 Regulating T Cell Proliferation And Differentiation In The Pathogenesis Of Psoriasis

Objective:Psoriasis is an immune-mediated disorder,which is mediated by T cells and multiple immune cells.It is mainly characterized by the dominant differentiation of Th1cells and Th17 cells,accompanied by the dysfunction of Th2 cells and Tregs.The imbalance of Th1/Th2 and Th17/Treg differentiation is closely related to the abnormal expression of their corresponding transcription factors.Bromodomain-containing protein2 is a critical transcriptional regulator.In the preliminary study of changes in m RNA expression patterns of peripheral blood T cells in psoriasis,the abnormal expression of BRD2 was discovered.Furthermore,in the research of various immune diseases both domestically and abroad,it has been confirmed that BRD2 plays a crucial role in the functional differentiation of T cells in various directions towards Tn.This study mainly investigates the mechanism of BRD2 in regulating T cell proliferation and differentiation in psoriasis patients from the perspective of Tn autoactivity disorders,in order to provide new ideas for the pathogenesis and treatment of psoriasis.Methods:1.Peripheral blood mononuclear cells were isolated from 6 patients with moderate psoriasis vulgaris and 6 healthy volunteers from a medical examination center using density gradient centrifugation.The m RNA and protein expression levels of BRD2 in PBMCs were detected by RT-q PCR and Western blot,respectively.2.High-expression BRD2 and control plasmids with GFP fluorescent protein tags were designed based on the NM＿005104.4 transcript sequence of the human BRD2 gene(Gen Bank＿ID:6046)in the CDS region on NCBI.Three sh RNA plasmids with GFP fluorescent protein tags were selected based on the human BRD2 gene to knock down BRD2,with the following target sequences:5’CCTATGGACATGGGTACTATT3’,5’CCTACCACTGTCCTCAACATT3’,and 5’CCGGAAGCCCTACACCATTAA3’.3.Lentivirus infection was used to construct two stable T cell models with low expression/control and high expression/control of BRD2.The fluorescence efficiency was monitored periodically under a two-photon microscope,and the transfection efficiency was confirmed by RT-q PCR and Western blot.4.Constructing a psoriasis KC model:Ha Ca T cells were seeded into T25 flasks and cultured until reaching 50%confluency.The cells were starved for 24 hours and then switched to 2%fetal bovine serum medium with the addition of 5μL of M5 at a concentration of 10ng/m L.The flasks were then placed in a 37℃,5%CO2 incubator and cultured for an additional 48 hours.At this point,the Ha Ca T cells became psoriasis-like KCs,which could induce T cell differentiation.6.Transfected T cells with psoriasis-like KC treatment to simulate KC-T cell interaction in psoriasis,KC were seeded at 2×10~5cells/well in the upper chamber of Transwell,and T cells were seeded at 1×10~6cells/well in the lower chamber of Transwell.After incubation at 37°C with 5%CO2 for 48 hours,T cell morphology,quantity changes,and proliferation activity of each group were observed under an inverted microscope using the CCK8 method.RT-q PCR was used to detect the expression of specific transcription factors T-bet,GATA3,RORγt,and Foxp3 corresponding to Th1,Th2,Th17,and Treg subtypes of differentiated T cells.Results:1.Compared with normal individuals,RT-q PCR detection showed no significant difference in the expression level of BRD2 m RNA in the peripheral blood mononuclear cells of psoriasis patients,but the protein expression of BRD2 was significantly increased.2.According to the NM＿005104.4 transcript sequence of BRD2 and the 5’CCTATGGACATGGGTACTATT3’target sequence,the stable T cell models with BRD2overexpression and low expression were successfully constructed.3.After lentivirus transfection of Jurkat cells for 48 hours,the green fluorescence efficiency of the transfected cells was observed under a two-photon microscope,which was stable at around 70%-80%。Compared with the OV-NC group,both m RNA and protein expression levels in the OV-BRD2 group were more than twice as high as their respective controls.Compared with the KD-NC group,the KD-a,KD-b,and KD-c groups with low expression were selected,and the KD-a group(with about 50%knockdown of BRD2 m RNA and protein)was used for subsequent experiments.4.After 48 hours of treatment with psoriasis-like KC,transfected T cells were observed under an inverted microscope,appearing as translucent round or elliptical shapes with relatively uniform size,clustered together.Furthermore,it was observed that compared to the OV-NC group,the OV-BRD2 group had larger and denser cell clusters,indicating that BRD2 promotes the proliferation and clustering of T cells.In comparison to the KD-NC group,the KD-BRD2 group had smaller and sparser cell clusters,indicating that the absence of the BRD2 gene inhibits the proliferation and clustering ability of T cells.5.Further CCK8 assays were performed to measure the proliferation activity of T cells in different groups.The results showed that there was no significant difference in cell viability between the OV-BRD2 group and the OV-NC group from 0 to 24 hours.However,from 48 to 72 hours,the cell viability of the OV-BRD2 group was higher than that of the OV-NC group,and the difference in cell viability between the two groups was statistically significant,with the most significant difference observed at 72 hours.On the other hand,the cell viability of both the KD-BRD2 group and the KD-NC group gradually increased with time.There was no significant difference in cell proliferation activity between the two groups from 0 to 24 hours.However,from 48 to 72 hours,the cell viability of the KD-BRD2 group was lower than that of the NC group,and the difference in cell viability between the two groups was statistically significant,with the most significant difference observed at 72 hours,as shown by repeated measurement variance analysis.6.RT-q PCR was performed to detect the expression of specific transcription factors corresponding to Th1,Th2,Th17,and Treg subtypes after T cell differentiation under different levels of BRD2.The results showed that,the expression of the Th1-specific transcription factor T-bet(10.44±0.63)and the Th17-specific transcription factor RORγt(10.73±0.34)was upregulated after overexpressing BRD2,while the expression of the Th2-specific transcription factor GATA3(6.03±0.63)and the Treg-specific transcription factor Foxp3(13.36±0.39)was downregulated.In contrast,the expression of T-bet(12.54±0.65)and RORγt(9.28±0.72)was downregulated,while the expression of GATA3(9.19±0.29)and Foxp3(13.86±0.57)was upregulated after BRD2 knockdown,and all had statistical significance.Conclusion:1.The expression level of BRD2 in peripheral blood mononuclear cells of psoriasis patients was increased,consistent with previous research results.2.According to the NM＿005104.4 transcript sequence of BRD2 and the 5’cctatggacatgggtactatt3’target sequence,the stable T cell models with BRD2overexpression and low expression were successfully constructed.3.Knocking down BRD2 expression can inhibit T cell proliferation.4.After knocking down BRD2 expression,T cell differentiation towards Th1 and Th17 was inhibited,while differentiation towards Th2 and Treg was promoted.BRD2may become a potential therapeutic target for psoriasis and other immune-mediated diseases.