Basic Research On The Application Of PNA-Based Nucleic Acid Selective Amplification Technique For Enrichment Of Plasma Cff-DNA In Pregnant Women

Objective:Non-invasive prenatal genetic testing（NIPT）using cell-free fetal DNA（cff DNA）in maternal plasma is one of the most promising strategies to prevent and treat fetal genetic disorders.However,the lack of low-cost and efficient methods for selective enrichment of cff DNA in the context of high maternal DNA is one of the challenges that hinder the development and diffusion of its technology.Therefore,this study aims to establish a new method,named as PNA based nucleic acid size selection PCR（PNA-NASS PCR）,for selectively amplifying cff DNA in maternal plasma at low cost and high throughput,which combines the application of peptide nucleic acid（PNA）and a modified nucleic acid size selection（NASS）technique.Methods:（1）The PNAs and primers were designed using software of vector NTI 11.0 and Primer 5.0 and validated by polymerase chain reaction（PCR）and agarose gel electrophoresis.（2）The amplified DNA fragments were recovered by a standard agarose gel DNA recovery kit,and a peripheral blood model of a pregnant woman carrying a male fetus（SRY gene model）was constructed by using the amplified DNA fragments.（3）The PNAs were ligated with upstream primers of short fragments using click chemistry,then separated and purified using polyacrylamide gel electrophoresis（PAGE）and high performance liquid chromatography（HPLC）.The ligated products were identified using mass spectrometry.（4）The PNA-NASS PCR reaction system was constructed by serial diluting PNA conjugates with primers,and the optimal concentration was screened.（5）Performance evaluation of PNA-NASS PCR using the SRY gene model,which includes enrichment efficiency,sensitivity,and specificity.Results:（1）Two pairs of primers for establishing the SRY gene model,S-F（ACAGGCCATGCACAGAGAGA）,S-R（TGTCCAGTTGCACTTCGCTG）,L-F（AAATGTTAGCCATCCTAGAAGTTGGG）,and L-R（TGTCCAGTTGCACTTCGCTG）,and the PNA（TCTGATACTTAATGCCTGTGAA）required for constructing the PNA-NASS PCR reaction systemand were screened,and then validated by conventional PCR and agarose gel electrophoresis.（2）The cell free DNA environment in the peripheral blood of pregnant women was successfully simulated by mixing long DNA fragments and short DNA fragments at a concentration of 216.67 GE/ml in a volume ratio of 9:1,which were recovered with an agarose gel cutting and recovery kit and purified with agarose gel electrophoresis.（3）The reaction product of the click chemistry ligation of PNA and upstream primer of short DNA fragment（conjugate of PNA-forward primer of the short fragment,PNA-PS）,was separated by denaturing PAGE,purified by HPLC,and then identified by mass spectrometry.The result of the denaturing PAGE showed a band at the expected position of PNA-PS.The HPLC results showed that the peak of PNA-PS appeared earlier than the peak of PNA and primers.The mass spectrometry data analysis showed that the molecular weight of S-F was 6457.3 Da,the molecular weight of PNA was 4098.3 Da,while the molecular weight of PNA-PS was10546.2 Da.Therefore it was inferred that PNA-PS was synthesized successfully.（4）The PNA-NASS PCR reaction system was composed of 8.67 GE/ml of DNA template,0.05μM of PNA-PS,0.4μM of downstream primers,and 12.5μl of Taq PCRase.（5）The performance evaluation of the PNA-NASS PCR reaction system showed that the enrichment efficiency for cff DNA was 142.95-fold,the specificity for selective amplification of fetal free DNA was99.89%,and the detection limit for cff DNA was 10E^-5 ng/μl.Conclusion:In this study,we jointly applied the properties of PNA and a modified nucleic acid size selection technique to establish PNA-NASS PCR system that selectively enriches cff DNA in maternal plasma.The novel method can overcome the current shortage of simple,rapid and specific enrichment of fetal DNA in maternal plasma and will provide support for the routine clinical application of NIPT.