Font Size: a A A

Molecular Mechanism Of HnRNPA1 Enhancing SCRIB 16 Exon Skipping And Promoting The Invasion And Metastasis Of Breast Cancer

Posted on:2022-07-05Degree:MasterType:Thesis
Country:ChinaCandidate:B ZhangFull Text:PDF
GTID:2504306734467634Subject:Microbial and Biochemical Pharmacy
Abstract/Summary:PDF Full Text Request
Background:The incidence of breast cancer accounts for the top three in the world,and the main cause of patient cure rate is tumor metastasis.In breast cancer cell metastasis,pre-mRNA abnormal splicing plays an important role,these proteins produced by abnormal splices in most cases promote breast cancer migration.According to the alternative splicing mechanism,ASO(antisense oligonucleotide)can alter gene expression as a method of treating breast cancer metastasis.For example,antisense oligonucleotide oligo AB is designed according to the splice site sequence of BRCA1,which can increase the skip of exon 11 of BRCA1(BRCA1 associated ATM activator 1 gene ID:221927)and reduce the expression of BRCA1-FL(full length)and BRCA1-Δ11q(partial retention of exon 11)to change the splicing of BRCA1 pre-mRNA to achieve the purpose of treating breast cancer metastasis.In the previous report,both,SCRIB(scribble planar cell polarity protein,Gene ID:23513)and hnRNPA1(heterogeneous nuclear ribonucleoprotein A1 Gene ID:3178)are related to breast cancer metastasis,and hnRNPA1 can regulate exon 16 of SCRIB to produce two kinds of mRNA,with deletion and containing exon 16,but the mechanism of splicing and the function of SCRIB isoforms in the process of breast cancer metastasis are not clear.At the same time,according to the specific mechanism of SCRIB splicing,the focus of this study is to design whether the specific antisense oligodeoxynucleotides that interfere with its splicing can maintain stability and achieve the purpose of treating breast cancer metastasis.Objective:The purpose of this study is to explore the molecular mechanism of hnRNPA1 alternative splicing of SCRIB16 exons and the role and difference of Scrib isoforms and SCRIB antisense oligonucleotides in breast cancer metastasis,so as to provide new ideas for the treatment of breast cancer metastasis.Methods:1.HnRNPA1 content analysis in MDA-MB-231,MCF-7 cells and clinical samples: RT-q PCR and Western-blot methods were used to detect the difference of heterogeneous ribonucleoprotein A1(hnRNPA1)transcription and translation between high metastatic cell line MDA-MB-231 and low metastatic cell line MCF-7.Using UALCAN database and R2 database to analyze the molecular expression level of hn NPA1 in normal breast tissue and breast cancer tissue,and the relationship between hnRNPA1 and prognosis of patients.2.Relationship between hnRNPA1 and breast cancer cell migration: Scratch healing experiment and trans-well test the effect of hnRNPA1 overexpression or down-regulation on the metastasis of breast cancer cells MDA-MB-231 and MCF-7.Western-blot detects the effect of hnRNPA1 on the phosphorylation of AKT and ERK.3.Screening of downstream target genes of hnRNPA1: After hnRNPA1 was overexpressed or knocked out in breast cancer cells,the target genes downstream of hnRNPA1 were screened by RT-PCR.SCRIB-minigene was introduced into cells to detect the splicing of exogenous SCRIB by hnRNPA1.UALCAN database and R2 database were used to analyze the molecular expression level of SCRIB gene in normal breast tissue and breast cancer tissue and its relationship with prognosis.4.The relationship between abnormal splicing of SCRIB and cell migration of MCF-7 and MDA-MB-231: The effect of SCRIB isomers on breast cancer MCF-7 and MDA-MB-231 cell metastasis was verified by scratch healing experiments and trans-well experiments.5.The impact of SCRIB isomers on downstream pathways: Co-immunoprecipitation verified the binding ability of SCRIB-L(including exon 16),SCRIB-S(deleting exon 16)and PPP1CA(protein phosphatase 1 catalytic subunit alpha,Gene ID: 5499).Western-blot was used to detect the effects of SCRIB-L and SCRIB-S on AKT,ERK phosphorylation and EMT related proteins.6.Study on the Mechanism of hnRNPA1 regulating SCRIB Alternative Splicing: Use Minigene-MS2 immunoprecipitation experiment to verify whether SCRIB pre-mRNA can bind to hnRNPA1.RNA immunoprecipitation(CLIP)experiment to determine the approximate site where hnRNPA1 and SCRIB pre-mRNA intersect.Afterwards,RNA-pulldown and Minigene-MS2 site mutation experiments were used to verify the specific site of hnRNPA1 binding to SCRIB pre-mRNA.7.The effect of ASO-SCRIB on breast cancer cell migration: antisense oligodeoxynucleotides specifically binding to SCRIB pre-mRNA binding site were designed.The effect of SCRIB antisense oligodeoxynucleotides on the metastatic ability of breast cancer cells was tested by scratch test and invasion and migration test.8.The relationship of HnRNPA1-SCRIB splicing in tumor metastasis: The two-factor method was used to verify the dependence between HnRNPA1 and SCRIB.Construct a nude mouse metastasis model,and observe the metastasis of cancer cells to lung by HE staining.Results:1.HnRNPA1 is highly expressed in breast cancer cells and clinical samples: hnRNPA1 is highly expressed in clinical samples of patients with liver cancer,and the high expression of hn RNA1 is related to the poor prognosis of patients.At the same time,the expression of HnRNPA1 in high metastatic breast cancer cell line MDA-MB-231 was higher than that in low metastatic breast cancer cell line MCF-7.This indicates that hn RNA1 may be related to the metastasis of breast cancer.2.HnRNPA1 promotes breast cancer cell migration: Scratching,migration and invasion experiments showed that the overexpression of hnRNPA1 promoted the migration of breast cancer cells,while the knockout of hnRNPA1 inhibited the migration of breast cancer cells.The results of WB experiment show that hnRNPA1 can promote the phosphorylation of ERK and AKT to promote the metastasis of breast cancer.3.SCRIB is a downstream target gene of hnRNPA1: RT-PCR and minigene experiment results show that overexpression of hnRNPA1 promotes the production of SCRIB-S,and knockdown of hnRNPA1 promotes the production of SCRIB-L.4.Decreasing the expression of SCRIB-S inhibits the migration of MDA-MB-231 and MCF-7:Scratching,migration and invasion experiments showed that SCRIB long isomer knockout(sh-SCRIB-L)promoted breast cancer cell migration,while SCRIB short isomer knockout(sh-SCRIB-S)inhibited breast cancer cell migration.5.Contrary to SCRIB-L,SCRIB-S activates downstream ERK and AKT pathways: IP experiments show that SCRIB-L has a strong binding ability with PPP1 CA,while SCRIB-S has a weak binding ability with PPP1 CA.The weak combination of SCRIB-S and PPP1 CA increases the phosphorylation levels of ERK and AKT,thereby increasing breast cancer metastasis.SCRIB-L can inhibit the phosphorylation of ERK and AKT to promote breast cancer migration.6.HnRNPA1 protein binds to SCRIB pre-mRNA Intron15 to inhibit the splicing of SCRIB exon16: CLIP experiment,Minigene-MS2 experiment and RNA-pulldown experiment show that hnRNPA1 can bind to the "caggatggaggcgcccgtgccagg" sequence in intron 15 of SCRIB pre-mRNA,thus promoting the production of SCRIB short isomer(SCRIB-L).7.ASO-SCRIB reduces the migration ability of breast cancer cells: antisense nucleic acid experiments show that antisense nucleic acid can target SCRIB,increase the production of SCRIB-L,and thereby inhibit the migration of breast cancer cells.8.HnRNPA1 increases breast cancer cell invasion partly depends on the expression of SCRIB-S: Two-factor experiments show that hnRNPA1 promotes breast cancer metastasis partly depends on SCRIB.The lung metastasis model shows that hnRNPA1 and SCRIB-S can increase the metastasis of cells MDA-MB-231 to the lungs.Conclusions:HnRNPA1 is highly expressed in breast cancer clinical samples and highly metastatic breast cancer cells,and the prognosis is poor.Contrary to SCRIB-L,hnRNPA1 and SCRIB-S can promote the metastasis of breast cancer cells through ERK and AKT pathways.In addition,hnRNPA1 can directly bind to intron 15 of SCRIB pre-mRNA,thus promoting the formation of SCRIB-S.More importantly,RNA-pulldown,scratch healing and invasion experiments showed that SCRIB antisense oligodeoxynucleotides could effectively inhibit the binding of hnRNPA1 and SCRIB,thus inhibiting the metastasis of breast cancer.The summary is as follows:1.HnRNPA1 was highly expressed in clinical samples of breast cancer,and the survival rate of patients with high expression of hnRNPA1 was significantly decreased.And overexpression of hnRNPA1 in breast cancer cells can promote the metastasis of breast cancer cells.2.In breast cancer cells,overexpression of hnRNPA1 can promote the production of SCRIB-S,knockdown of overexpression of hnRNPA1 can promote the production of SCRIB-L,and the target gene regulated by hnRNPA1 is SCRIB.3.SCRIB-L and SCRIB-S have opposite functions.SCRIB-L inhibits the migration of MDA-MB-231 and MCF-7,while SCRIB-S promotes the migration of MDA-MB-231 and MCF-7.The binding ability of SCRIB-L and SCRIB-S to PPP1 CA is different,the binding ability of SCRIB-L to PPP1 CA is strong,while that of SCRIB-S to PPP1 CA is weak,which shows that SCRIB-L inhibits the phosphorylation of ERK,while SCRIB-S promotes the phosphorylation of ERK.4.HnRNPA1 binds to the "caggatggaggcgcccgtgccagg" sequence of intron 15 in SCRIB pre-mRNA to inhibit the splicing of exon 16,resulting in SCRIB-S.5.SCRIB antisense oligodeoxynucleotides block the binding of hnRNPA1 and SCRIB pre-mRNA,thus inhibiting the abnormal splicing of SCRIB regulated by hnRNPA1.6.SCRIB antisense oligodeoxynucleotides can inhibit the migration of breast cancer cells by inhibiting the phosphorylated expression of ERK.Therefore,the regulation of abnormal splicing of exon SCRIB16 by hnRNPA1 and SCRIB ASO plays an important role in the metastasis of breast cancer,which may provide a new target for the treatment of breast cancer.
Keywords/Search Tags:Metastasis
PDF Full Text Request
Related items