Effects of immunostimulatory DNA sequences on bovine immune responses

The purpose of this study was to test the hypothesis that oligonucleotides (ODN) containing a CpG motif (CpG ODN) will stimulate an enhanced Th1 dominated immune response. In chapter one, the effects of CpG ODN were compared for stimulation of bovine B lymphocyte proliferation. The optimal CpG ODN was then tested for induction of cytokines in peripheral blood mononuclear cells (PBMC) and purified B lymphocytes, monocytes and macrophages. At a high ODN concentration (40 μM), all but two CpG ODN tested stimulated B cell proliferation, which was dependent on unmethylated CpG motifs. CpG ODN 2059 containing the GTCGTT motif shown to activate human leukocytes also promoted the highest level of bovine B cell proliferation at a lower concentration (10 μM) when compared with CpG ODN containing AACGTT or GACGTT motifs active for murine leukocytes. Furthermore, ODN 2059 induced IL-6 production by B lymphocytes and IL-6 and IL-12 production by PBMC, monocytes, and macrophages. In contrast, IL-1β and TNF-α production were either very low or undetectable. Consistent with increased IL-12 production, ODN 2059 also stimulated IFN-γ production by PBMC.; In chapter two, the study was designed to test the hypothesis that the nuclease resistant phosphorothioate modified ODN 2006 (TCGTCGTTTTGTCGTTTTGTCGTT) would induce antigen-specific type 1 cytokine and enhanced IgG responses similar to those induced by IL-12. To test this adjuvant effect, calves were immunized with Anaplasma marginale major surface protein 2 (MSP2) with alum alone or combined with CpG ODN 2006, non-CpG ODN R2006 or IL-12. MSP2-specific IgG1 and IgG2 responses developed more rapidly in calves given IL-12, ODN 2006 or ODN R2006, but the highest IgG1 titers were obtained in CpG ODN-immunized calves. Antigen-specific lymphocyte proliferation and frequency of IFN-γ-secreting cells were significantly increased in CpG ODN 2006- or IL-12-treated calves, and as expected, antigen-stimulated PBMC from these calves also expressed higher levels of IFN-γ transcripts and lower levels of IL-4 transcripts. No differences in IL-10 mRNA expression were detected among the groups. These results indicate that CpG ODN 2006 is an effective vaccine adjuvant for stimulating both antibody and IFN-γ mediated cellular immune responses in ruminants.