Font Size: a A A

Pathogenic EDA Mutations In Chinese Han Families With Hypohidrotic Ectodermal Dysplasia And Genotype–phenotype: A Correlation Analysis

Posted on:2021-03-27Degree:MasterType:Thesis
Country:ChinaCandidate:Y HanFull Text:PDF
GTID:2404330611958366Subject:Dermatology and Venereology
Abstract/Summary:PDF Full Text Request
Aims This study aimed to investigate the genetic causes of hypohidrotic ectodermal dysplasia(HED)in two families and elucidate the molecular pathogenesis of HED in Chinese Han patients.The genotype-phenotypic correlation analysis of HED was expected to provide theoretical basis for individualized treatment and genetic counseling of HED patients.Methods 1)Whole-exome sequencing(WES)was used to screen HED-related genes in two family members,followed by confirmatory Sanger sequencing.2)After verification by Sanger sequencing,ANNOVAR software was used to annotate and predict the gene function of the mutations,to indicate whether the mutations founded were pathogenic or not.3)We reviewed HED-related articles in Pub Med.All statistical analyses were performed with SPSS version 16.0 software.χ2-test and Fisher’s test were used to analyze the genotype–phenotype correlations.Results 1)WES identified EDA missense mutations(c.1127 C>T [p.T376M;NM001005609] in family 1 and an EDA nonframeshift deletion mutation(c.648683del ACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC [p.216228del PPGPPGPPGPQGP;NM001005609])in family 2.Sanger sequencing validated the results.ANNOVAR(ANNOtate VARiation)annotation indicated that c.1127 c>T in family 1 was a deleterious missense mutation.The mutation could cause amino acid changes and further affect protein structure.2)The review of published papers revealed 68 mutations related to HED: 57(83.8%)were EDA mutations,8(11.8%)were EDAR mutations,2(2.9%)were EDARADD mutations,1(1.5%)was a WNT10 A mutation,31(45.6%)were missense mutations,23(33.8%)were deletion mutations,and 1(1.5%)was an In Del.3)Fisher’s test statistics indicated EDA missense mutation and EDA deletion mutation in the clinical manifestations of hypohidrosis analysis p value is 0.021(P < 0.05).Conclusions 1)This study identified two EDA gene mutations in two Chinese Han HED families,which were previously reported.2)It was found that 83.8% of the mutations in HED patients were EDA gene,most of which were missense mutations,mainly occurred in the TNF homologous domain.3)Statistical analysis of genotype phenotype correlation found that the frequency of hypohidrosis was higher in patients with hypohidrotic ectodermal dysplasia with EDA gene missense mutations.4)The results of this study were helpful to guide the HED patients personalized treatment strategies,and provided a molecular genetic basis for gene diagnosis and genetic counseling of HED.
Keywords/Search Tags:Hypohidrotic ectodermal dysplasia, Whole-exome sequencing, Sanger sequencing, Ectodysplasin A gene, Gene mutation
PDF Full Text Request
Related items