| Background:Angiogenesis is the growth of new blood vessels from existing capillaries after the body is exposed to the outside effectors,which is a process of growth and reconstruction from the original vascular network to the complex vascular network.The angiogenesis process consists of a variety of biological behaviors of endothelial cells,including activation of endothelial cells,proliferation,differentiation and migration of endothelial cells,and tube formation.Therefore,vascular endothelial cells play the most important role in angiogenesis.The formation of new blood vessels in adult individuals is mainly through angiogenesis.Angiogenesis plays an important role in the development and progression of many diseases,such as tumors and diabetes.To explore the mechanism of abnormal angiogenesis and to block abnormal angiogenesis is of great significance for the treatment of angiogenesis related diseases.Tie2 is a tyrosine protein kinase receptor specifically expressed in endothelial cells,which can be activated by its ligand Angiopoietin(Ang).In animal models with the deletion of Tie2 gene,Tie2 has been proved to be of great significance for embryonic vascular development.Study shows that Tie2 signaling promotes angiogenesis by promoting endothelial cell proliferation and vascular remodeling.Netrin4(NTN4)is a secreted protein that is structurally related to laminins.In addition,NTN4 regulates angiogenesis.Both in vivo and in vitro experiments have demonstrated that stimulation with soluble NTN4 protein markedly promotes angiogenesis by inducing proliferation,migration and tube formation of vascular or lymphatic endothelial cells.The Notch signaling is highly conserved between species and is critical for differentiation,proliferation and fate determination.Notch1,Notch3,Notch4 receptors and DLL1,DLL4,Jagged1 and Jagged2 ligands are expressed in ECs.Both loss-of-function and gain-of-function of Notch1 signaling leads to severe vascular defects during vascular development.Notch signaling coordinates tip and stalk endothelial cell behaviour and is therefore critical for proper interpretation of cues regulating angiogenic guidance and morphogenesis.It has been reported that Notch1 regulates endothelium-specific genes,such as vascular endothelial cadherin(VE-cadherin)and platelet endothelial adhesion molecule-1.This study hypothesized that the activated Notch1 signaling pathway regulates the expression of endothelial angiogenic factors Tie2 and NTN4,and further revealed the molecular mechanism by which Notch1 regulates the expression of Tie2.Our findings may provide a new therapeutic target for the treatment of angiogenesis related diseasesObjective:1.To investigate the effect of activated Notch1 pathway on angiogenic factors NTN4 gene expression in endothelial cells.2.To explore the effect of activated Notch1 pathway on angiogenic factors Tie2 gene expression in endothelial cells and molecular mechanism.Method:1.Effect of Notch signaling on Tie2 and NTN4 gene expression in cultured HUVECs1.1 Effect of Notchl intracellular domain(NICD1)on Tie2 and NTN4 gene expression in cultured HUVECsHuman umbilical vein endothelial cells(HUVECs)were transfected with lentiviral particles comprising the coding sequence of the Notchl intracellular domain(NICD1),and NICD1-transfected HUVECs were obtained.These cells were abnormally overexpressed NICD1 protein.Cells were collected and cell culture medium were also collected.We examined Tie2 expression with Western blotting,qPCR and immunofluorescence(IF)in NICD1-infected HUVECs.The effect of NICD1 on NTN4 expression was detected by Western blotting assay and qPCR assay.The effect of NICD1 on NTN4 secretion was detected by Western blotting assay and coomassie bright blue staining with cell culture medium.1.2 Effect of DLL4 ligand-mediated activation of Notch1 on Tie2 gene expression in HUVECsTo mimic Notchl activation under physiological condition,HUVECs were cultured in Delta-like ligand 4(DLL4)-coated dishes.After 24 hours,cell culture medium were also collected.We examined Tie2 expression with Western blotting,qPCR and IF in DLL4-treated HUVECs.1.3 Effect of inhibitor of Notch signaling on Tie2 and NTN4 gene expression in HUVECsTo explore the effect of Notch on Tie2 receptor,we use dibenzazepine(DBZ),a y-secretase inhibitor which blocks proteolytic cleavage of Notch receptor,to stimulate HUVECs for 24 hours.Cell culture medium were also collected.We examined Tie2 and NTN4 expression with Western blotting and qPCR in HUVECs.The effect of NTN4 secretion was detected by Western blotting assay and coomassie bright blue staining.2.Effect and mechanism of activated Notchl on GATA3 in HUVECs2.1 Effect of Notch1 intracellular domain(NICD1)on GATA3 gene expression in cultured HUVECsActivation of Notch signaling in HUVECs was achieved by infection of lentiviral particles comprising the coding sequence of the Notchl intracellular domain(NICD1).We examined GATA3 expression with Western blotting,qPCR and IF in NICD1-infected HUVECs.2.2 Effect of DLL4 ligand-mediated activation of Notchl on GATA3 gene expression in HUVECsTo mimic Notchl activation under physiological condition,HUVECs were cultured in Delta-like ligand 4(DLL4)-coated dishes.After 24 hours,we examined GATA3 expression with Western blotting,qPCR and IF in DLL4-treated HUVECs.2.3 Effect of inhibitor of Notch signaling on GATA3 gene expression in HUVECsTo explore the effect of Notch on Tie2 receptor,we use dibenzazepine(DBZ),aγ-secretase inhibitor which blocks proteolytic cleavage of Notch receptor,to stimulate HUVECs for 24 hours.We examined GATA3 expression with Western blotting and qPCR in DBZ-treated HUVECs.2.4 Effect of Notch 1 intracellular domain(NICD1)on GATA3 gene transcription in HUVECsNICD1-infected HUVECs were cracked by ultrasonic fragmentation.We add NICD1 antibody to chromatin fragment to capture target DNA fragment.After separation and purification,we use GATA3 primer for PCR to detect the binding of NICD1 and GATA3 promoter.3.Effect of GATA3 on Tie2 expression in HUVECs3.1 Effect of siRNA for GATA3 on Tie2 expressionTo verify the effect of GATA3 on the expression of Tie2,we transfect 40nM si-GATA3 into HUVECs.We examined GATA3 expression with Western blotting and qPCR in HUVECs.3.2 Effect of GATA3 plasmid on Tie2 expressionTo verify the effect of GATA3 on the expression of Tie2,we transfect 2.5ug plasmid on every well of 6-well Cell culture plate.We examined GATA3 expression with Western blotting and qPCR in HUVECs.4.The effect and mechanism of GATA3 in Notchl regulation of Tie2 expression in HUVECs4.1 The role of GATA3 in Notch1 regulation of Tie2 expression in HUVECsTo further verify the role of GATA3 in Notch1 regulation of Tie2 expression in HUVECs,we transfect si-GATA3 on NICD1-infected HUVEC to silence GATA3.We examined Tie2 expression with Western blotting and qPCR in HUVEC.4.2 Mechanism of GATA3 in Notch1 regulation of Tie2 expression in HUVECsNICD1-infected HUVEC was cracked by ultrasonic fragmentation.We add GATA3 antibody to chromatin fragment to capture target DNA fragment.After separation and purification,we use Tie2 primer for PCR to detect the binding of GATA3 and Tie2 promoter.Plasmid containing NICD1 encoding sequence was constructed by pRL-CMV vector.pGL3-basic polyclonal vector was used to construct plasmid containing Tie2 promoter fragment and GATA3 mutant plasmid,where the Tie2 promoter was selects-405 to+318 fragments and+98 GATA3 mutation of Tie2 promoter was mutated from GATAAGTGTTTTGATGAATTGCGAGATGGATA to TCGCAGTGTTTTTC GTAATTGCGAGATGTCGC.After transfection with 0.75ug plasmid and Lipofectamine 3000 reagent,we detect the fluorescence intensity and analyze the effect of GATA3 on the regulation of Tie2 promoter by Notch1.Result:1.Effect of Notch1 signaling on Tie2 expression in cultured HUVECsThe result show that mRNA and protein expression levels of Tie2 and NTN4 were significantly increased in NICD1-transfected HUVECs,NTN4 was also significantly increased in cell culture.Compared with the control,the expression level of Tie2 was higher in the DLL4 ligand-treated HUVECs.Whereas the expression level of Tie2 and NTN4 were significantly decreased in the DBZ-treated HUVECs and NTN4 was also significantly decreased in cell culture.2.Effect and mechanism of activated Notchl receptor on GATA3 expression in culture of HUVECsResult show that NICD1-transfected HUVEC group,GATA3 mRNA and protein expression level was significantly increased compared with control group.In DLL4 ligand-treated HUVECs,GATA3 expressed was increased.On the contrary,GATA3 expression was significantly reduced in DBZ-treated HUVECs.ChIP results show that NICD1 combined to-9488 binding sites of GATA3 promoter and activate GATA3 promoter activity.3.Effect of GATA3 on Tie2 expression in HUVECsThe results showed that compared with the control,the mRNA and protein levels of Tie2 were significantly decreased after si-GATA3-treated in HUVECs,whereas the mRNA and protein levels of Tie2 were increased after GATA3 expression plasmid-treated in HUVECs.4.The effect and mechanism of GATA3 in Notchl regulation of Tie2 expression in HUVECsResult show that compared with control group(si-control),NICD1-infected HUVECs after treated with the si-GATA3,NICD1-induced Tie2 increase was reduced.After treated with the si-GATA3,Tie2 expression has no statistical difference between in NICD1-infected HUVECs and empty vector-infected HUVECs.ChIP results show that NICD1 increase the combination between GATA3 and Tie2 promoter,and enhance the Tie2 promoter activity,result in an increase of Tie2 expression.The DLR results confirmed that NICD1 significantly enhanced the activity of Tie2 promoter Tie2 promoter activity significantly decreased when GATA3 binding site mutation NICD1 had no statistically significant effect on Tie2 promoter activity when GATA3 binding site mutation.Conclusion:The activated Notch1 receptor up-regulates the expression of Tie2 and NTN4 in endothelial cells.The increase of Tie2 is achieved by targeting GATA3 with Notch1,and the up-regulated GATA3 then up-regulates the expression of Tie2. |
PDF Full Text Request