| Objective:This study will use the RNA sequence data(RNA-seq)in the public database Cancer Gene Atlas(TCGA)to screen the key LncRNA related to the prognostic of colorectal cancer and conduct cytological research.To provide a basis of further mechanism research,and further explore the LncRNA of colorectal cancer patients with diagnostic and prognostic significance.Methods:The CRC-related RNA-seq data onto 647 cases and 51 cases of precancerous tissues were downloaded from the tumor gene atlas(TCGA)database.The LncRNA matrix was extracted by Perl,and the LncRNA with differential expression was analyzed by batch survival analysis to select Significant target LncRNA is verified for the next step;by analyzing the expression levels of the above target LncRNA in cancer and adjacent tissues,the differences in target LncRNA expression levels are compared and verified;target LncRNA is analyzed for gene function and pathway enrichment;Bioinformatics technology analyzes and predicts the possible regulatory relationship between this target LncRNA and target genes,and clarifies the role of this target LncRNA in the diagnosis and prognosis of patients with CRC.HCT116,SW620,SW480,and HT29 cell lines were cultured,and qRT-PCR experiments were performed to detect the expression level of the target Lnc RNA in the four cell lines.Designed siRNA(Small interfering RNA;siRNA)fragments that specifically inhibit the expression of the target LncRNA After the transfection of the corresponding cells,CCK8,scratch and transwel experiments was performed to observe the changes in cell behavior,and to determine the effect of the target LncRNA on the cell proliferation,migration and invasion.Results:LncRNA-CLDN10-AS1 with significant prognostic significance and differential expression was analyzed and screened using bioinformatics technology.After analysis of the database,the expression of CLDN10-AS1 in CRC tissues was significantly higher than that in normal tissues adjacent to the cancer(P<0.001).Analysis of gene enrichment revealed that LncRNA CLDN10-AS1 is involved in multiple biological behaviors of cells.HT29 and SW480 had relatively high CLDN10-AS1 expression levels in the four cell lines(P<0.05).The siRNA sequence 5’-CACCGCTGAGCATGTGGGTCCTTATCGAAATAAGGACCCACATGCTCAG C-3 ’has obvious gene silencing efficiency(P<0.05).CLDN10-AS1 siRNA was successfully synthesized.After the expression of CLDN10-AS1 was inhibited by RNA interference(RNAi)technology,The proliferation,invasion and migration ability of SW480 and HT29 cells were significantly reduced(p<0.05).Conclusion:1.There are a large number of LncRNA expression differences in colorectal cancer tissues,which are closely related to the occurrence and development of tumors.Among them,the expression of CLDN10-AS1 in colorectal cancer tissues is significantly increased,suggesting that patients have a poor prognosis.2.Bioinformatics technical analysis suggests that LncRNA CLDN10-AS1 plays an important role in the occurrence and development of CRC and is related to multiple biological behaviors.3.It can provide guidance of judging the prognosis of CRC patients and designing related experiments.CRC cell experiments have shown that CLDN10-AS1 can promote the invasion,proliferation,and migration of colorectal cancer cells SW480 and HT29,and play a role similar to cancer-promoting genes,which has potential significance of patient diagnosis,prognosis judgment and clinical treatment. |