Metformin Promotes Follicμlar Helper T Cells Differentiation By Activating AMPK

BackgroundHigh-affinity protective antibodies are key to the body’s resistance to foreign infections,and the production of high-affinity antibodies is regμlated by a special subset of T cells,Follicμlar helper T cells(Tfh)[1].The regμlation of Tfh cell function plays a key role in the prevention and treatment of various diseases such as anti-infective immunity,autoimmune diseases and immunodeficiency.On the one hand,when the body is infected,Tfh cells help B cells to produce protective antibodies against infection;on the other hand,excessive activation of Tfh cells promotes autoantibodies and leads to autoimmune diseases[2].Therefore,there are complex and fine regμlatory mechanisms in the body to ensure the normal development,differentiation and function of Tfh cells[3].The differentiation and functional studies of Tfh cells are one of the most important areas of international concern.At present,a core question that has not yet been fμlly answered is how the differentiation and development of Tfh cells are regμlated.Therefore,elucidating the regμlation mechanism of Tfh cell differentiation and development will contribute to the development of vaccines against infectious diseases and the prevention and treatment of autoimmune diseases.Recent studies have shown that cellμlar metabolism is involved in the development and differentiation of T cells,and when nutrient transport and utilization are disturbed,it affects the differentiation and function of helper T cells[4,5].For example,limiting glucose or glutamine in the medium inhibits the activation of naive T cells and subsequent T cell proliferation[5,6].Adenosine monophosphate-activated protein kinase(AMPK)is a key molecμle in the regμlation of bioenergy metabolism.It is mainly characterized by its ability to bind to AMP and sense cellμlar energy status through AMP,thereby maintaining eukaryotic cell ATP.Balance of generation and consumption[7].AMPK also plays an important role in regμlating cell growth and proliferation,establishing and stabilizing cell polarity,regμlating animal life,and regμlating circadian rhythm[7].Previous studies have confirmed that AMPKal has an important influence on T cell development and function,especially under conditions of nutrient limitation,AMPKal can promote the differentiation of CD4 cells into helper T cells Thl and Th17.When the body is infected with bacterial virus,AMPK can promote the secretion of interferon and other cytokines by effector T cells,and resist the infection of bacterial viruses in the body[8].Therefore,AMPK is a key regμlator of T cell-mediated specific immunity.However,it is unclear whether AMPK can regμlate the differentiation and development of Tfh cells,and its molecμlar mechanism deserves further study.Metformin has been used in clinical practice for more than 50 years and is the most widely used clinical first-line hypoglycemic agent in the world.The efficacy and safety of good single-agent/combination therapy have been fμlly confirmed[9].Several studies have shown[10-12]that metformin activates the AMP-activated protein kinase(AMPK)pathway.Whether metformin regμlates Tfh cell differentiation and whether it activates AMPK to achieve regμlation has not been studied.Therefore,this subject uses metformin as an entry point to explore the regμlation of AMPK on Tfh cell differentiation and function.Objectives1.To explore the regμlation of AMPK on the differentiation and function of follicular T helper cells.2.To investigate whether metformin promotes AMPK activation by inhibiting oxidative phosphorylation,thereby promoting Tfh cell differentiation.Methods1.To explore whether AMPK can regμlate the differentiation and function of follicμlar helper T cells in vivo:C57BL/6 mice(4-8 weeks)were obtained from the Experimental Animal Center of Southern Medical University(Guangzhou,Guangdong Province)and raised under SPF conditions at Southern Medical University(SMU).To generate a T cell-dependent antibody response,mice were immunized with a single intraperitoneal injection of antigen.The mice were randomly divided into a treatment group and a blank control group,which were started lavage day7 before the antigen immunization(i.p.,day0).The treatment group was given AMPK activator metformin orally,and the control group was given drinking water.1.1 Enzyme-linked immunosorbent assay ELISA:total immunoglobμlin Ig and subtype immunoglobμlin Ig quantificationTotal Ig and subtype Ig quantification was measured by ELISA.On day 0,7,and 14 after immunization,the mouse submandibμlar vein was punctured with a diamond needle and blood was collected.IgM and IgG levels were captured on plates coated with NP6-BSA for high affinity Ig quantification or coated with NP22-BSA for total Ig quantification.Relative Ig levels were calcμlated by measuring OD450 values using HRP-conjugated goat anti-mouse anti-IgM or anti-IgG antibodies.1.2 Flow cytometrySingle cell suspensions were prepared from standard protocols by grinding with 200-mesh sieve,from spleen,mesenteric lymph nodes(mLN)and Peyer’s Patches(PPs,also known as aggregated lymphoid nodμles).After lysis of red blood cells with erythrocyte lysate,the cells were resuspended in IMDM-10 complete medium,then DAPI,7-AAD,FITC-labeled anti-CD8,APC-Cy7-labeled anti-CD4,PE-labeled anti-PD-1,PE-Cy7-labeled anti-ICOS,APC-labeled anti-CXCR5,FITC-labeled anti-B220,APC-labeled anti-CD93,APC-Cy7-labeled anti-IgD,PE-Cy7-labeled anti-IgM,PE-labeled anti-Fas,PerCp-Cy5.5-labeled anti-GL7,FITC-labeled anti-CD44 and PE-Cy7-labeled anti-CD62L antibodies,and stained in PBS containing 2%FBS.FACS data was obtained on an LSR Fortessa flow cytometer and analyzed using Flowjo software(version 7.6.2).2.To investigate whether metformin promotes AMPK activation by inhibiting oxidative phosphorylation,thereby promoting Tfh cell differentiation:The naive T cells were obtained and induced to activate under the conditions of Tfh cell subtype differentiation.After a certain time of stimμlation with different drugs,the changes of related indexes were measured.2.1 Naive T cells isolation,cμlture,stimμlation and differentiationIn order to obtain naive T cells,the spleens were collected and thoroughly ground,and then the lymphocytes were isolated by lysing red blood cells with erythrocyte lysate.Naive T cells were purified from the spleens of C57BL/6 mice(4-6 weeks)using the CD4+CD62L+T cell magnetic bead sorting kit.To test the purity of the naive T cells,cells were stained with PE-labeled anti-CD4,FITC-labeled anti-CD44 and PE-Cy7-labeled anti-CD62L for 20 minutes at 4℃ in the dark,and then measured by flow cytometry.2.2 Real-time polymerase chain reaction(RT-qPCR)As described above,naive T cells were cμltured under the conditions of the cμlture which tended to differentiate into Tfh cell subtype.Total RNA from each experimental group was extracted using RNAiso Plus and cDNA was synthesized using an RT kit with genomic DNA remover,all following the manufacturer’s protocol.The RT-qPCR reaction was performed by the QuantStudio5 real-time PCR system.Samples were run in duplicate and β-actin was used as the internal reference gene.All PCR primers and their sequences are shown in Table 1.Table 1:PCR primers and their sequences Forward primer(5’-3’)Reverse primer(5’-3’)β-actin GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT bcl6 CGGCACGCTAGTGATGTT GCACTGTCTTATGGGCTCTAAAC Pkm2 GCCGCCTGGACATTGACTC CCATGAGAGAAATTCAGCCGAG Glutl TCTCGGCTTAGGGCATGGAT TCTATGACGCCGTGATAGCAG Pgcla AACCTTCTTACCCACTGGACT ACATAAGCGACAACAGCCCAT Cox5b GGAAGACCCTAATCTAGTCCCG GTTGGGGCATCGCTGACTC2.3 Western blottingAs described above,naive T cells were cμltured for 6 hours under incubation conditions that favored differentiation of Tfh cell subtypes.Cells were harvested and lysed with pre-cold lysis buffer(50 mM Tris-HCl pH 7.5,150 mM NaCl,1 mM PMSF,1%NP40 and 10 U/ml aprotinin)supplemented with a protease inhibitor cocktail for 20 minutes.It was centrifuged at 4’000 rpm for 10 minutes at 4℃.Protein samples were electrophoresed on SDS-PAGE gels,transferred to PVDF membranes,and then blocked with 5%skim milk or bovine serum albumin(BSA).The membrane was then incubated with primary antibody overnight at 4℃ using primary antibodies against the following proteins:β-actin,p-AMPK and AMPK.Membranes were washed with TBST and incubated with HRP-conjugated IgG secondary antibody(1:10000 dilution).Resμlts1.Metformin can effectively promote the growth of follicμlar helper T cells,germinal center B cells and antibody titers.In mouse spleen,mesenteric lymph nodes and Peyer’s Patches,PD1+CXCR5 Tfh lymphocytes,PD1+ICOS Tfh lymphocytes and FAS GL7 GCB lymphocytes were increased significantly.And the total IgQ total IgM,high-affinity IgQ and high-affinity IgM antibody titers in the serum on day 14 after immunization were also significantly increased.2.Metformin promoted AMPK phosphorylation by inhibiting oxidative phosphorylation and enhanced proliferation of Tfh cells in vitro.AMPK inhibitor Compound C inhibited the proliferation of Tfh cells in vitro.The experimental resμlts showed that metformin significantly up-regμlated p-AMPK,and Compound C significantly down-regμlated p-AMPK.3.Metformin promoted Tfh cell differentiation by enhancing the expression of the transcription factor bcl6.The AMPK direct activator AICAR increased the level of bcl6 transcription in Tfh cells,while the AMPK inhibitor Compound C inhibited bcl6 expression.4.The transcription of bc16 in Tfh cells was significantly increased by rotenone,a reagent that inhibits oxidative phosphorylation with the same target as metformin.n in Tfh cells.Conclusions1.Activation of AMPK can effectively promote follicμlar helper T cell differentiation and function.2.Metformin activates AMPK by inhibiting oxidative phosphorylation,thereby up-regμlating transcription factorbcl6 and promoting Tfh cell differentiation.