| Objective Calnexin(Canx)is a type I transmembrane protein and an important endolectin chaperone of the endoplasmic reticulum.It monitors the folding and assembly of eukaryotic cells and regulates the Ca2+ homeostasis and Ca2+homeostasis of the endoplasmic reticulum.The signal transduction process leads to a variety of important biological functions.Our previous study found that Schistosoma japonicum(Sj)Canx(SjCanx)gene has significant differential expression in lung phase schistosomulum under the influence of different host factors.In this paper,the effect of the gene on the growth of Schistosoma japonicum was studied.After the clone and expression of its protein,the immunoprotective effect of the recombinant protein was observed.It provided basic data for the exploration of new vaccine and drug targets.Methods:The bioinformatics analysis of SjCanx amino acid sequences was performed using online tools.The Clustal X2 software was used to compare SjCanx and other Species of Canx amino acid sequences.The SjCanx three-dimensional pattern was drawn using the Swiss Model online tool and the SjCanx was constructed using Mega 5.5 sofeware.Other species are homologous phylogenetic trees.Collected different stages of Schistosoma japonicum to extracte RNA,reverse RNA transcribed into cDNA.Real-time quantitative polymerase chain reaction(qPCR)show that the mRNA expression of SjCanx genes in different stages of development.The siRNA of SjCanx gene was designed and synthesized.The cercariae of Schistosoma japonicum were transformed into schistosomulum by mechanical comminution and co-cultured with schistosomula.The schistosomiasis was collected and cultured for 6 days and placed under light microscope.Observation,photographing,and using IPP 6.0 software for morphological statistical analysis of schistosomulum;using qPCR to detecte gene silencing rate.Total RNA of adult S.japonicum was extracted and cDNA was obtained by reverse transcription.Specific primers were designed and synthesized based on the corresponding SjCanx extracellular gene sequence.The cDNA was used as a template for amplification.The target gene and pET28a(+)plasmid were double digested and ligated.And transformation,picking positive clones,sequencing after PCR detection and identification;extracting and sequencing the correct plasmid DNA,transforming it into the prokaryotic expression host strain BL21;picking positive clones and inducing expression of the target protein with IPTG,SDS-PAGE,western blot The expression results were detected and the recombinant protein(rSjCanx)was purified by immunomagnetic beads.New Zealand rabbits were immunized with purified rSjCanx to obtain polyclonal antisera.Immunohistochemistry was used to locate the distribution of the target gene in schistosomula.The BALB/c mice were immunized with rSjCanx for 3 times.After 2 weeks of the last immunization,30±1 cercariae of S.japonicum were infected.After 42 days,the mice were dissected,the adult worms of Schistosoma japonicum were collected by perfusion,and 0.5 g of left liver tissue was removed.Eggs were collected after digestion and counted under a microscope to calculate the rate of worm reduction and egg reduction.The right hepatic tissue of soybeans was fixed and HE stained to measure the area of granuloma formed by individual eggs and the area reduction rate was calculated.Group comparison;blood was collected from fundus veins at the same time,serum was collected,and ELISA was used to determine the levels of Thl and Th2 cytokines IL-4 and IFN-y.Results:Bioinformatics analysis showed that the molecular formula of SjCanx was C2949H4528N782O907S18;SjCanx is a stable hydrophilic transmembrane protein with high homology with SmCanx and a similarity rate of 84%.qPCR revealed that SjCanx gene was expressed in different developmental stages.It also showed that the mRNA expression of SjCanx was highest in the lung schistosomula infected for 3 d and lowest in the eggs.After 6 d treatment with siRNA,the length,width,area and volume of schistosomula were 145.79±26.08μm,53.25±9.56 μm,(2.88±0.67)×104μm2,(20.88±7.42)×x104 μm3,those were significantly lower than those in the control control group(159.36±35.74 μm,56.33± 9.45 μm,(3.30 ± 0.73)×104 μm2,(25.62±9.27)×104 μm3(P<0.05);compared with NC control group,qPCR showed that the silencing rate of SjCanx was 55.4%(P<0.05).According to the corresponding gene sequence of SjCanx extracellular segment,the forward primer is CGGGATCC AATCCTGAGTTAGAACCTGAAG and reverse primers is CCGCTCGAGTTTC TCATTGTAAGTTTCCCG.The recombinant expression plasmid pET28a(+)-SjCanx was constructed,then detected by western-blotting and its size was the same as the theoretical molecular weight,which was approximately 53.5 kDa.rSjCanx immunized rabbits,anti-sera obtained by ELISA assay titer of 1:12800.The results of immunohistochemistry showed that the SjCanx was mainly located in the essence and pellicle of the schistosome.The results of immunoprotection showed that the worm reduction induced by rSjCanx was 10.36%(P>0.05),the egg reduction rate was 30%(P<0.05),and the area of liver granuloma caused by single eggs was(0.157±0.036)×105 μm2.Compared with adjuvant group the area of granulomas was reduced by 23%(P<0.05).The ELISA assay for sera showed that IFN-y and IL-4 were 19.75±5.38 pg/ml,7.56±1.92 pg/ml in blank control group;22.05±5.05 pg/ml,7.60±2.53 pg/ml in adjuvant group and 37.33±8.07 pg/ml,7.65±2.18 pg/ml in immune group;Statistical analysis found that IFN-γ in the immunized mice was significantly higher than that in the adjuvant group(P<0.05).However,there was no significant difference in IL-4(P>0.05).Conclusion:The silencing of SjCanx gene affects the growth and development of schistosomula,suggesting that SjCanx plays an important role in the growth and development of schistosomula;cloning and expressing SjCanx extracellular segment;rSjCanx can produce a 30%ovulation rate.The mechanism may be achieved by enhancing the Thl type cytokine IFN-y immune response. |
PDF Full Text Request