| BackgroundTumor stem cells(TSCs)are defined as cells which are endowed with self-renewal and multilineage differentiation potential.The theory of TSCs has provided new insights into tumor initiation,drug resistance,metastasis,recurrence,assessment of clinical course and prediction of prognosis.The existence of TSCs was verified in acute myelogenous leukemia(AML).Later they were found in some solid tumors,including NPC.CD133 is a surface glycoprotein which was discovered as one of the molecular markers of hematopoietic stem cells.It may be a marker of TSCs in different tumor types.In our previous study we purified CD 133(+)human nasopharyngeal carcinoma cells with MicroBeads.The theory and the discovery of TSCs provide a foundation for the future development of new therapies to target TSCs in the treatment of NPC.The standard treatment for NPC is radiotherapy.Different therapeutic genes are becoming more and more promising in human cancer therapy with the development of cell biology and molecular biology.Suicide gene therapy mediated by the herpes simplex virus thymidine kinase gene/ganciclovir system has a very attractive property called the ’bystander effect’.Because of this,tumor cells that are not transduced with the suicide gene also become sensitive to prodrugs and eliminated along with suicide gene-transduced cells.Successful gene therapy technology relies on the delivery of the therapeutic product into appropriate target cells.Progress in our investigation of somatic stem cells,especially the finding that mesenchymal stem cells(MSCs)can migrate to tumor cells(MSCs tumor-homing),open up new avenues to use MSCs as delivery vehicles for targeted gene therapy of NPC.In this study,the suicide gene TK was introduced into MSCs by recombinant lentiviral vector.Cytotoxicity and bystander effect were measured by co-culture of TK-MSCs and CD133(+)human nasopharyngeal carcinoma cells.ObjectiveTo investigate the therapeutic effects of TK-MSCs in combination with Ganciclovir(GCV)on CD133(+)human nasopharyngeal carcinoma cells.Materials and Methods1 MaterialsDMEM/F12 medium、RPMI-1640 medium、DMEM medium、Opti-MEM medium,Adipogenic/osteogenic/chondrogenic differentiation medium for mesenchymal stem cells,fetal bovine serum,Percoll gradient,PEI(polyethylenimine),Polybrene,thymidine kinase gene primers,p-Actin primers,PCR kit,DNA Marker,restriction endonuclease,T4 DNA Ligation Kit,DNA gel extraction kit,PCR product purification kit,a large amount of plasmid extraction kit,M-MLV first strand cDNA Synthesis Kit,Protein Marker,MACS CD133 Cell Isolation Kit,Transwell inserts,Cell Counting Kit-8,plasmid pGL3-TK-EGFP,plasmid pCDH-CMV-HA-TK-EF1-copGFP(a kindly gift of Ke Lan,Institute Pasteur of Shanghai,Chinese Academy of Sciences),human nasopharyngeal carcinoma cell line5-8F,human microvascular endothelial cell line ECV,Sprague Dawley(SD)rats,BALB/c nu/nu mice.2 Methods2.1 Isolation and Culture of MSCsBone marrow was taken out from the bilateral femora of SD rats,mononuclear cells were separated by centrifugation in Percoll gradient(density=1.073g/ml),suspended in Dulbecco’s Modified Eagle Medium:Nutrient Mixture F12(DMEM/F12)Media containing 10%FBS and seeded at a concentration of 1.5×105 cells/ml.After 3 days,nonadherent cells were removed by washing with phosphate-buffered saline(PBS),and the monolayer of adherent cells was cultured until confluence.Flow cytometry was applied to detect the expression of CD29,CD34,CD44 and CD45.MSCs were cultured in adipogenic,osteogenic or chondrogenic differentiation medium of SD rats.The differentiation potential was defined by the appearance of adipogenic,osteogenic,and chondrogenic phenotypes,which were revealed after Oil Red,Alizarin Red,and Alcian Blue staining,respectively.Cell Counting Kit-8 was used for cell proliferation assay,quadruples of MSCs(3,000 cells per well)were plated into 96-well plates and incubated overnight at 37 ℃,5%C02.Add 10 μl of the CCK-8 solution to each well of the plate.Incubate the plate for 1-4 hours.From the second day,the absorbance at 450 nm was measured using a microplate reader at the same time point every day.After 10 days,the data obtained were used to draw a growth curve and to calculate population doubling time(PDT).2.2 Construction of Lentiviral Vector pCDH-CMV-HA-TK-EFl-copGFPTK gene(NCBI accession number AY575228)was amplified by PCR fro m plasmid pGL3-TK-EGFP using the following primers:TK-F CGCGAATT CGCCACCATGTACCCATACGATGTTCCAGATTACGCTATGGCTTCGTACCC CTGCCATCAAC,the HA-tag coding sequence(ATGTACCCATACGATGTTCC AGATTACGCT)was added to this forward primer;TK-R CGCGGATCCTCA GTTAGCCTCCCCCATCTCCCGGA lentiviral plasmid pCDH-CMV-HA-TK-EF1-copGFP which was kindly provided by Ke Lan(Institute Pasteur of Shanghai,China)was used as a backbone.HA-TK gene was cloned into the lentivirus plasmid via EcoRI and BamHI restriction sites.The reconstructed vector was confirmed by restriction enzyme digestion and DNA sequence analysis.2.3 Production of LentivirusLentivirus was prepared according to the manufacturer’s instructions.Briefly,293T cells were co-transfected with pCDH-CMV-HA-TK-EF1-copGFP(transfer),△8.9(packaging),and pVSVG(VSV-G envelope)plasmids using PEI in OptiMEM.24h later,media was replaced and incubated at 37 ℃,5%C02.Vector was collected 72h after transfection,filtered(0.2 μm),Concentrated,and frozen at-80℃.Titer was determined by transduction of 293T cells with limiting dilutions of vector and assessing the proportion of transduced cells 72h post-transduction.2.4 Transduction of MSCsMSCs were transduced at passage 3.For determination of the efficiency of MSC transduction,MSCs were exposed to vector at MOIs of 10,50and 100 with or without Polybrene(5μg/ml).Green Fluorescence was observed with fluorescent microscopy.HA-TK expression was verified by RT-PCR and Western blotting.2.5 Magnetic-activated cell sorting with CD133Briefly,107 5-8F cells were digested with trypsin to prepare single-cell suspensions,which were stained with anti-CD 133 MicroBeads and with FcR-blocking antibody for 30 min at 4℃.The cells were then washed and applied to a positive selection on Macs column placed in a magnetic field.The cells were allowed to pass through the column.The column was washed and then removed from the magnetic field.After two rounds of magnetic-activated cell sorting through specific columns in MicroBeads,positive and negative fractions were eluted.2.6 Identification of Tumor-HomingTumor-homing of TK-MSCs was analyzed by transwell inserts that were 6.5 mm in diameter with 8μm pore filters.CD133(+),CD133(-),5-8F or ECV cells(1×105)were incubated in serum-free medium in the lower well of the 24-well plates。24 h later,TK-MSCs(1×105)in serum-free medium were seeded into the upper well.After incubation for 12h,the nonmigrated cells were removed from the upper surface of the membrane using a cotton swab.Cells that had migrated to the lower surface were fixed with Paraformaldehyde and stained with crystal violet.The number of cells that had migrated to the lower side of the filter was counted under a light microscope with five fields(×400).2.7 Cytotoxicity AssayFor cytotoxicity assay,5x103 CD133(+)/CD133(-)/5-8F cells were seeded in a 96-well plate and divided into 6 groups:①control group 1(blank control),CD133(+)cells;②control group 2,CD133(+)cells,GCV(1 mg/L);③control group 3,CD133(+)cells,cultured supernatant of TK-MSCs after treated with GCV;④control group 4,CD133(-)cells and TK-MSCs,GCV;⑤control group 5,5-8F and TK-MSCs,GCV;⑥experiment group,CD133(+)cells and TK-MSCs,GCV.After 2 d,the number of living cells was determined by CCK-8.2.8 Co-cultured of TK-MSCs/GCV and CD133(+)5-8F cells at various ratiosCD133(+)cells(5×103)were co-cultured with various numbers of TK-MSCs(the various percentage of TK-MSCs was 0%,5%,20%,40%,60%,80%)in culture medium with 1 mg/L GCV for 2 d and the number of living cells was determined by CCK-8.Cell viability was expressed as the percent absorbance of the blank control(CD 133(+)cells only without GCV).2.9 Statistical AnalysisData were analyzed with SPSS13.0 statistical software and expressed as mean± standard deviation.Statistical comparisons of groups were performed’ using one-way ANOVA(The approximate variance F test/Welch method was used for variance nonhomogeneity).In multiple comparisons,LSD methord or Dunnett’ s T3 methord(variance nonhomogeneity)was used.P<0.05 was considered statistically significant.Result1\Isolation and Identification of MSCsMost cells were spindle shaped,whereas large flat cells and star-shaped cells were present at lower numbers.MSCs are positive for CD29(99.96%)and CD44(99.26%)and negative for CD34(3.04%)and CD45(1.14%).In adipogenic differentiation,fat droplets in the cells were stained with Oil Red.In osteogenic differentiation,the accumulation of mineral deposits was detected by Alizarin Red staining.In chondrogenic differentiation,cells formed a pellet,which was stained blue by Alcian Blue.Cell growth of MSCs was slow in the first day(latent phase),accelerated during days 2-5(logarithmic phase),and slowed down from day 6(stationary phase).PDT of MSCs in logarithmic phase was(31.7±0.5)h.2、Construction of Lentiviral Vector pCDH-CMV-HA-TK-EF1-copGFP In restriction enzyme digestion,1161bp band was observed.In DNA sequence analysis,a mutation(G33T)was found.As the coded amino acids did not change(both glutamine),the mutation was a kind of synonymous mutation which did not alter the encoded protein.3、Production of Lentivirus and Transduction of MSCs High-titer(1×108UT/ml)viral supernatant was produced successfully.In the.presence of Polybrene,transduction was effective,with about 95.1±0.1%transduction at an MOI of 50 versus 42.1±0.3%in the absence of Polybrene。1161bp band was observed after RT-PCR.42.6KD band was detected by Western blotting.4.Magnetic-activated cell sorting with CD 133 When cultured using serum-free culture medium,CD 133(+)5-8F cells grew non-adherently in clumps of cells rather than as monolayers.5、Identification of Tumor-Homing Only a few cells migrated toward normal human somatic cells ECV.However,tumor cells(CD 133(+)5-8F cells,CD133(-)5-8F cells or unsorted 5-8F cells)significantly stimulate the migration of TK-MSCs compared with ECV(P=0.000).Moreover,migration of TK-MSCs toward CD133(+)5-8F cells was much higher(P=0.000 for comparisons with both group 2and group 3).6、Cytotoxicity AssayTK-MSCs/GCV exerted strong antitumor effect on CD133(+)5-8F cells(P=0.000 for the comparison with blank control).cytotoxic effect of Cultured supernatant of TK-MSCs after treated with GCV was weaker than that of TK-MSCs/GCV.TK-MSCs/GCV significantly inhibited growth of CD133(-)5-8F cells and unsorted 5-8F cells compared with CD 133(+)5-8F cells(P 0.000 for both comparisons).7.Bystander Effect of TK-MSCs/GCVWhen the percentages of TK-MSCs were 0%和 5%,cell viabilities were 98.4±3.1%and 97.0±2.3%,respectively.When the percentage of TK-MSCs was up to 20%,a favorable bystander effect was observed with 68.2±2.3%cell viability.An increase in bystander effect was observed along with the increase in the percentage of TK-MSCs.Conclusion1、Highly purified MSCs can be separated by centrifugation in Percoll gradient.MSCs are positive for CD29 and CD44 and negative for CD45,CD34;they are able to differentiate to osteoblasts,adipocytes,and chondroblasts under standard in vitro differentiating conditions.2、The recombinant lentiviral vector pCDH-CMV-HA-TK-EF1-copGFP was successfully constructed.High-titer viral supernatant was produced and resulted in a transduction efficiency of over 95%.3、CD 133 can be a surface marker for tumor stem cells 5-8F cells.TK-MSCs maintained their homing to tumor cells,especially to TSCs.TK-MSCs/GCV exerts a bystander killing effect and inhibited the growth of CD133(+)cells significantly. |