| Objective To investigate the effect of radiosensitivity on human Eca109 and OE19 cells when silencing epidermal growth factor receptor(EGFR) gene by si RNA.Methods ECa109 and OE19 cell lines were cultured in vitro. Different si RNAsegments for EGFR gene, including EGFR-si RNA1(UGAUCUGUCACCACAUAAUUACGGG,CCCGUAAUUAUGUGGUGACAGAUCA), EGFR-si RNA2(UUAGAUAAGACUGCUAAGGCAUAGG,CCUAUGCCUUAGCAGUCUUAUCUAA), EGFR-si RNA3(UUUAAAUUCACCAAUACCUAUUCCG,CGGAAUAGGUAUUGGUGAAUUUAAA),and negative-si RNA were designed,synthesized and transfected into human Eca109 and OE19 cells by lipofectamine 2000.Then, they would be observed by Fluorescence microscope and authenticated byRT-PCR and Western blotting. CCK-8 was used to evaluate cell growth to achieve theoptimal transfection condition. ECa109 and OE19 cells were classified into three groups:control group,irradiation group,EGFR si RNA-irradiation group. The radiosensitivityof different groups was studied by clonogenic survival curves. Finally we analyzedcell-cycle distribution and cell-apoptosis detected by Flow cytometry.Results There existed EGFR gene and protein expression in ECa109 and OE19 cells. Both the two cell lines were transfected easily with Cy3-si RNA when observed byfluorescence microscopy. Lipofectamine 2000 reagent itself had no effect on the growthof two cell lines according to CCK-8. EGFR-si RNA can downregulate EGFRexpression evidently. The radiosensitivity of two cell lines tranfected withEGFR-si RNA were intensified,with lower D(0),D(q) and SF(2) values. Comparingwith OE19 cell,Eca109 cell got a higher SER(1.40 vs 1.01). Flow cytometry suggestedthat the G2/M phase cells percentage and the apoptosis rate increased more obviously inEca109 cell when tranfected with EGFR-si RNA as well as exposed with irradiation. Itwas statistically significant. However, cell-cycle distribution of OE19 cell line gotscarcely change.Conclusions Silencing EGFR could enhance the radiosensitivity of esophagealsquamous cell carcinoma more effectively than esophageal adenocarcinoma. It can bereflected that silencing EGFR could inhibit sublethal damage-repair more effectively,affect cell cycle distribution more significantly, and increase cell apoptosis moreobviously. |