Effect Of RNA Interference Mediated PI3K Gene Downregulation On Estradiol Activation In Human Endometrial Carcinoma Cell Line Ishikawa

Endometrial carcinoma is a common female genital tract malignancies with increasing morbidity reported worldwide in recent years. It is well-known that the risk for endometrial carcinoma increases in patients with high estrogen levels that are unopposed by progestin. The specific mechanism has been no definite conclusion. Previous study showed that, estradiol can induced the production of VEGF, bFGF and IL-8 via a mechanism involving activity of PI3K/Akt signaling pathway. According to the previous experiment, we selected PI3K gene for further experiment. To clear the correlation between PI3K/Akt signaling pathway and estradiol activation in endometrial carcinoma cell, useing RNA interference mediated PI3K gene downregulation expression on the endometrial carcinoma cell line Ishiawa, and then explores the impact of estradiol activation of Ishikawa cell, and the growth of transplantation tumor of nude mice. Whether PI3K gene can become the new target of molecular treatment of endometrial carcinoma is discussed.Part I PI3K shRNA lentiviral vector’s constructed and established Ishikawa stable transfected cell line[objective]Based on the previous experiment, we found estradiol can induced the production of VEGF, bFGF and IL-8 via a mechanism involving activity of PI3K/Akt signaling pathway. To clear the relationship between PI3K/Akt signaling pathway and estradiol activation in endometrial carcinoma, in this part, PI3K gene downregulation expression in Ishikawa by using RNA interference, and then established Ishikawa stable transfected cell line to lay the foundation for the research of the influence on estradiol activation of Ishikawa cells.[Method]1.4 groups of siRNA sequences specific forPI3K gene were designed, and plasmid vector with PI3K shRNA was constructed and infected of Ishikawa.2. The PI3K gene’s expression was confirmed by RT-PCR and western blot, and the best target effect on silence was chosed.3. Slow virus was packed, application of RT-PCR and Western-blot showed the best target effect on silence to infection to Ishikawa cell.4.The stably silenced expression of PI3K cell was selected by flow sorting technology and the gene silencing efficiency of these recombinants was confirmed by RT-PCR and Western blot.[Results]l.The best interference target was identified by RT-PCR and Western blot, the sequence was GAGACCAATACTTGATGTGGTTGA CTAA.2. The best interference target of LV-shRNA-PI3K lentiviral vector was successfully constructed, and packed with high virus of 8×108 TU/ml, observed under inverted fluorescence microscopy, the transduction rate was approximately 90%, the lentiviral shRNA was successfully constructed and transduced into the Ishikawa cells.3. The stably silenced expression of PI3K cell was selected by flow sorting technology and the gene silencing efficiency of these recombinants was confirmed by RT-PCR and Western blot[Conclusion]RNA interference can inhibit PI3K expression effectively on endometrial carcinoma cell line Ishikawa, which laid a foundation for the subsequent experiment.Part II Effect of RNA interference mediated PI3K gene downregulation on Estradiol Activation in human endometrial cell line Ishikawa[Objective]In order to clear the correlation between PI3K/Akt signaling pathway and estradiol activation in endometrial carcinoma, in this part, PI3K gene downregulation expression in Ishikawa by using RNA interference, and then observed cell proliferation, cell cycle and apoptosis of Ishikawa cells which were silenced by PI3K, in order to get better understand the relationship between PI3K/Akt signaling pathway and estradiol activation in endometrial carcinoma.[Method]1. The PI3K-shRNA-transfected cell and untransfected cell was treated by E2., The effects on VEGF,bFGF were analyzed through RT-PCR and western blot.2. The effects on cell survival of the PI3K-shRNA-transfected were examined by MTT assay, to analysis the effect on cell survival rate of these cells after silencing the PI3K gene.3. The effects on migration of the PI3K-shRNA-transfected were examined by transwell assay, to analysis the effect on migration index of these cells after silencing the PI3K gene4. The cell cycle and apoptosis of each group were treated by E2 were measured by FCM, which was used to study the effect on cell cycle and apoptosis of these cells after silenced PI3K gene of Ishikawa cells.[Results]1. The abilities of proliferation in Ishikawa cell were increased after estradiol stimulation. (P< 0.05) There was no difference of abilities of proliferation in non-transfected group and NC-transfected group (P>0.05).The abilities of proliferation in PI3K-RNAi-LV group was significantly lower than the other two groups (P< 0.05)2. The abilities of migration in Ishikawa cell were increased after estradiol stimulation. (P< 0.05) There was no difference in migration index in non-transfected group and NC-transfected group (P>0.05).The a migration index in PI3K-RNAi-LV group was significantly lower than the other two groups (P<0.05)3.The apoptosis rate in Ishikawa cell were increased after estradiol stimulation. There was no difference of apoptosis rate in non-transfected group and NC-transfected group (P>0.05).The apoptosis rate in PI3K-RNAi-LV group was significantly higher than the other two groups (P< 0.05)4.The G0/G1-phase cell population of Ishikawa cell were decreased after estradiol stimulation. There was no difference in non-transfected group and NC-transfected group (P>0.05).The G0/G1-phase cell population in PI3K-RNAi-LV group was significantly increased than the other two groups,while the S-phase cell population and the G2-phase cell population were decreased (P<0.05)(Conclusion]RNA interference can inhibit PI3K expression inhibit cell proliferation and promote cell apoptosis. Our findings implied that PI3K could serve as a potential target for EC therapy.Part III Establishment of a endometrial carcinoma nude mouse xenograft model with low expression of PI3K gene[Objective]To observed the effect on the transplanted tumors growth of endometrial carcinoma nude mouse xenograft model with low expression of PI3K gene, and further explore the relationship between PI3K gene and endometrial carcinoma, which to provide experimental evidence for the gene therapy of endometrial carcinoma.[Method]Nude mice were randomly divided into three groups, each group has 6 nude mice. Ishikawa cells infected with PI3K shRNA lentivirus (PI3K -RNAi-LV group), scrambled shRNA-transfected group (NC group) and non-transfected group (Control group) were respectively inoculated to subcutaneous of nude mices’s back. We observed the growth of transplanted tumors, determined time of tumor formation. After these transplanted tumors were formatted, the long diameter (a) and short diameter (b) of tumor were measured every 3 days. According to the formula:tumor volume V= 0.5×axb2 to calculate the volume of tumor and draw the curve of tumor growth. Expression of p-PI3K、p-AKT、 VEGF、bFGF activity in xenograft tumors of each groups assessed by Western blot.[Results]The model of transplanted tumors of nude mouse of endometrial carcinoma was successfully constructed. Compared with the other two groups, the tumor growth of PI3K gene silent group is slow, the average tumor volume less then the Ishikawa group and the NC group (P< 0.05)。There was no difference in PI3K、p-Akt、VEGF、bFGF protien expression between NC group and Ishikawa group. Compared with the other two groups, the t expression of PI3K、p-Akt、VEGF、bFGF protein in PI3K gene silent group was decreased CP<0.05)[Conclusion]Inhibition the expression of PI3K gene can effectively inhibit the growth of transplanted tumors of nude mouse of endometrial carcinoma. Pi3k gene may become the molecular targets of EC.