Based On Gene Expression Differences In The Fat Body Of Silkworm DGE Technology And Correlation Analysis Of F1 And Heterosis

Bombyx mori （Silkworm） is a representative Lepidopteran and as an importanteconomically insect, It also has been domesticated and utilized for thousands of years.Studies of the silkworm Heterosis will help us to understanding the complexmechanisms and reasonable selection varieties for high economic properties. In order toobtained the heterosis-related gene(s), We used digital gene expression profile (DGE) tostudy the differential gene expression in fat body between F1-hybrid and their parentalinbreds, and its correlation to heterosis in silkworm reciprocal hybrids.1Differential gene expression between F1-Hybrid and their parental inbreds1.1DGE libraries are high-quality and information-rich.Firstly, we have successfully constructed eight B.mori DGE libraries fromorthogonal (75xin×7532) F1-hybrid, reciprocal cross (7532×75xin) F1-hybrid andtheir parental (Male and female are separated). Each library’s total Distinct Tag numbermore than120,000and Clean Tag number represent over37%. The tag’s copy numberwhich greater than100are predominantly in the total tag number, but the low copynumber which less than5are predominantly in the tag’s categories. All Clean Tag canmapped more than4,700functional genes,2,368and2,387genes can be simultaneouslydetected in F1-hybrid and parental in orthogonal and reciprocal cross combination,respectively. In the orthogonal combination,602,165,113and542transcripts were onlypresent in the7532male,75xin female, orthogonal F1male and orthogonal F1femalelibraries (specific expression), respectively. For the reciprocal cross combination,322,286,183and452were only present in75xin male,7532female, F1male, F1female,respectively.1.2Various types of differences gene expression between F1hybrids and parents.In this study, we according to the fold change of differentially expressed gene, theexpression pattern were divided into nine different types. We found that this patternswere vary from reciprocal hybrids and different genders, only74genes expressionpattern were the same types in orthogonal combination and reciprocal crosscombination. Overdominant, dominant, additive effects and other models can be found.In the orthogonal combination, the genes of F1female involved in germline ring canal inner rim and organelle envelope lumen were unique, but antioxidant, electron carrierand rhythm processe only appealed in F1male. In the reciprocal cross combination,antioxidant, electron carrier, metallochaperone, structural molecule and rhythm processwere unique in F1male.1.3The correlations differences gene expression patterns or levels with heterosisare considerably different.Correlation analysis of gene expression patterns showed: Under Male (UM), OverFemale (OF), Under Parents (UPS), Between Male and Female (MAF) were negativecorrelation with cocoon shell weight. However, the Under Female (UF) was significantpositive correlation and coefficient was0.920. UF was positive correlation with wholecocoon weigh and coefficient was0.897, followed by0.693of Between Female andMale (FAM). The OF and Over Parents (OPS) were negative correlation with wholecocoon weigh and coefficient was-0.887and-0.663, respectively. UF and FAM werepositive correlation with pupal weight and correlation coefficient were0.88and0.666,respectively. OF and OPS were negatively correlation and correlation coefficient were-0.900and-0.691, respectively. OF was positive correlation with cocoon shellpercentage and correlation coefficient was0.952, followed by OPS of0.924. UM andUF have shown a negative correlation, the correlation coefficient were-0.612and-0.622. These results indicate that there have correlations between the differential geneexpression patterns and silkworm heterosis, and this correlation showed different.2．Bioinformatics analysis of BmCTL16Tag: CATGGACCTAGTATCTCTCGA matching the predicted gene C-type lectin16(BmCTL16) in NCBI and open reading frame (ORF) is657bp with353amino acidresidues. By NCBI Blast,39related EST sequences were found and extended gene by385bp and63bp at3’ and5’ end after being spliced. Genome data showed thatBmCTL16contained three introns. There were2inter-disulfide bonds and1carbohydrate recognition domain(CRD) by predicted, and2Tyrosine kinasephosphorylation site,2Casein kimseII phosphorylation sites,3protein-kinase Cphosphorylation sites,1N-myristoylation site. The1-18amino acid was the predictedsignal peptide, and It be located in the extracellular (including wall) ratio was66.7% which indicating that it may be a secreted protein. EST expression analysis showedBmCTL16is expressed in the embryo, silking and pupal stage up-regulated expression,tissue microarray expression pattern showed BmCTL16(sw07855) is mainly expressedin epidermis, head of the midgut.