The Underlying Mechanisms Of Changes In BKca Channels In TG And TNC Of ION-CCiE Rats

ObjectiveTrigeminal neuralgia is one kind of neuropathic pain, as typical, atypical, and post-theropeutic trigeminal neuralgias, are the pain that is either spontaneous or can be elicited by harmless but crucial activities, such as eating and talking, or by light touch to the facial skin. The current treatments do not provide long lasting relief for these frequently treatment-refractory patients due to our limited understanding of their pathophysiology. Some researches have demonstrated that mRNA and protein expression of BKca channel was significantly decreased in the DRG, TG and TNC neurons of rats with neuropathic or inflammation pain. NS1619, the agonist of BKca channel, has been reported to significantly decrease neural firing rates and action potential amplitude through fast after-hyperpolarization (fAHP), and to significantly reverse the neuropathic pain induced by spinal L5-L6nerve ligation. However, the changes in BKca channel in Trigeminal neuralgia are yet unknown. The mitogen-activated protein kinase (MAPK) family, including extracellular signal-regulated kinase (ERK), p38and c-Jun N-terminal kinase (JNK), plays crucial roles in cell signaling and gene expression. Among these, p38MAPK is phosphorylated in primary afferent neurons after tissue inflammation, peripheral nerve injury and diabetic neuropathy. After the nerve injury, TNF-a increased in the DRG promotes p38MAPK phosphorylation in the primary afferent neurons and contributes to pain hypersensitivity. However, it is unknown whether the MAPK phosphorylation participates in the trigeminal neuralgia and how BKca channel changes. Here, we use animal behavior test, RT-PCR, western blotting, immunohistochemistry and whole cell patch-clamp recording to investigate the changes in BKca channel mRNA and protein expression, and the mechanism of (p-ERK, p-p38, p-JNK and p-Akt) phosphorylation in trigeminal neuralgia. Our study further illuminates the mechanism of trigeminal neuralgia and provides clues of new targets in clinical treatment of trigeminal neuralgia.1. Methods1.1AnimalsSD male rats (200-250g) facial mechanical threshold≥14.9g were randomly divided into two groups:ION-CCI group and sham group.1.2ION-CCI surgeryThe unilateral ligation of the ION was made according to the method described in our previous studies by Li (2008) and Imamura (1997) et al. Rats were anaesthetized with sodium pentobarbital (50mg/kg i.p.). An incision approximately0.5cm long was made along the inferior margin of the zygomatic arch. The incision was begun at the juncture between the zygomatic arch and nasal bone (near the back of the nose). Bluntly dissecting the muscle to exposure the infraorbital branch of the trigeminal nerve until it was clearly visible through the incision. About0.5cm of the ION was dissected free of adhering tissue, and two chromic gut ligatures (4-0) were loosely tied around it at about2mm apart. To obtain the desired degree of constriction, a criterion formulated by Bennett and Xie (1988,3) was applied:the ligatures reduced the diameter of the nerve by a just noticeable amount and retarded, but did not interrupt the circulation through the superficial vasculature. The scalp incision was closed using silk sutures (4-0). The contralateral sides were left intact in all rats. Sham operation was performed in the same manner except the ION was not ligated. All operations were performed aseptically and no antibiotics were administered.1.3Behavior experimentsFor mechanical allodynia studies, rat facial mechanical threshold in response to stimulation of Von Frey filaments. Stimuli were applied in an ascending order of intensity. Each of stimulation consisted of ten consecutive placements (interva1～10s) of the stimulus filament. The response threshold was considered as the lowest force of the filaments that produced a brisk head withdrawal; touching or scratching the facial regions upon mechanical stimulation.The filament of14.9g was chosen as the cut-off threshold. Withdrawal threshold was expressed as threshold level in gram. For the ION-CCI rats the facial mechanical threshold≤2g is succeed for the surgery, For the sham rats the facial mechanical threshold≥14g is succeed for the sham surgery. Then we compared the effect of BKca channel agonist NS1619,ERK antagonist U0126, p38antagonist SB203580, JNK antagonist SP600125and Akt antagonist LY294002of the ION-CCI rats facial mechanical threshold1.4ImmunohistochemistryAfter the rats were heavily anesthetized with4%paraformaldehyde perfusion, we quickly removed TG with PBS buffer rinsing and4%paraformaldehyde fixed for4h, then it was soaked in30%sucrose solution for1days. The embedded sections were incubated overnight at room temperature by BKca, p-ERK, p-AKT channel, ATF3primary antibody and NeuN primary antibody respectively; the second antibody incubated the sections the next day for1-2h.At last, we observe the BKca channel in the fluorescence microscope.1.5The whole-cell patch clamp recordingRats were decapitated and then rat trigeminal ganglion (TG) neurons we acutely isolated. Whole-cell patch-clamp technique was used to measure BKca currents and changes in membrane potentials from TG neurons at room temperature with an Axopatch200B amplifier (Axon Instruments, Foster City, CA, USA). Membrane potential held at-60mV, signals were filtered at2kHz (-3dB frequency, Bessel filter,80dB per decade), then digitized at10-50kHz (Digidata1320A interface, Axon Instruments).The leak current was subtracted from the potassium currents using Clampfit programs. Patch electrodes had resistance of2-5MQ.1.6The reverse transcription-polymerase chain reaction analysis(1) RNA isolation and complementary DNA synthesis Rats were decapitated after death, then TG were quickly removed, extracted RNA with Trizol. RNA purity was estimated by UV spectrophotometer (A260/280).Each sample was taken2μg in total20μl system in the reverse transcription into cDNA℃-20preservation until for real-time quantitative polymerase chain reaction amplification BKca channel gene.(2)RT-PCRUsed to amplify BKca channel a gene primers as:GAATGCATCTTGGCGTCACTC (justice), CCTCGAAGTGCATTCTCCTCAGC (antisense); reaction conditions:94℃,5min;94℃,35s;58℃,90s;72℃,90s.Used to amplify BKca channel β1gene primers as: ATGGAGGCTCAACCCAGATGG (justice), CCCATCTGCCCACAGCTGATA (antisense), β2gene primers as:ACTGCTGCGCTCGTACATGCA (justice), CGTTGGCCAGAAGAGAGAATGGA (antisense);β3gene primers for the GGCTGTAGAACCACCCAAGTC (justice), TCTTCTCTGGGAGAGCTGAC (antisense); β4gene primers for the CGAAGCTCAGGGTGTCTTACG (justice), CAGTGCAGGAGGACAATCTCG (antisense), β1,β2,β3,β4gene reaction conditions are the same a gene;β-actin gene primers as ATGGTGGGTATGGGTCAGAAG (justice), TGGCTGGGGTGTTGAAGGTC (antisense), reaction conditions:95℃,2min;95℃,20s;58℃,25s;72℃,25s.1.7Western blotRats were decapitated after death, then TG were quickly removed, with the rapid cleavage of RIP A lysate protein homogenate protein. We used BSA Law spectrophotometer (wave595) to measure protein concentration simultaneously. Extracted samples, each taken on the kind of60g protein to electrophoresis. Electrophoresis constant voltage120V for90min, followed by constant current300mA transmembrane for120min; skim milk closed the membrane and it was washed for3times. BKca, p-ERK, p-Akt channel first antibody incubated at4℃overnight, next day we washed the membrane at room temperature, followed by BKca, p-ERK, p-Akt Channel secondary antibody incubation for60min. At last, we developed photographs and make the statistical analysis of gray-scale measurements.2. Results2.1Mechanical allodynia after ION-CCIThe facial threshold in the region of operation side was decreased6days after ION-CCI surgery and remained at least until the42th day (**P<0.01vs sham group) which mimicked trigeminal neuropathic pain-like response. The effect of NS1619on mechanical allodynia was evaluated on postoperative day15in ION-CCI rats. Target injection of100μg NS1619in100μl saline dose-dependently increased the mechanical pain threshold in response to the von Frey hair filaments stimulation on the ION-CCI rats.2.2BKca expression after ION-CCIImmunohistochemical study demonstrated that compared to that in sham groups, the expression of ATF3in TG and TNC neurons of ION-CCI rats was significantly increased and the BKca expression was significantly decreased, especially in the diameter30-40μm TG neurons. QT-RT-PCR and western blot results demonstrated that compared to those in sham group, the BKca channel mRNA (α、β2、β4subunits) and protein expression were significantly decreased. 2.3Evaluation of functional BKca after ION-CCIWe used the whole cell patch-clamp to record action potential. The results showed that the action potential threshold intensity and the fast after-hyperpolarization amplitude of action potential was significant lower in ION-CCI rats than those in sham rats. Further, the BKca currents in TG neurons after ION-CCI surgery were significant lower than those in sham rats. The BKca currents in TG neurons could be blocked by channel selective blockers IbTX and Paxilline.2.4Effects of phosphorylation on mechanical allodynia in ION-CCI ratsThe effects of ERK antagonist U0126, p38antagonist SB203580, INK antagonist SP600125and Akt antagonist LY294002on mechanical allodynia were evaluated on postoperative day15in ION-CCI rats. Target injection of10μg U0126in20μl, SB20358010μg in20μl saline, SP60012510μg in20μl saline and LY294002100μg in20μl saline all increased the facial mechanical pain threshold in response to von Frey hair filaments stimulation on the ION-CCI rats.2.5Effects of phosphorylation on BKca currentsThe effects of ERK antagonist U0126, p38antagonist SB203580, JNK antagonist SP600125and Akt antagonist LY294002on BKca currents were evaluated on postoperative day15in ION-CCI rats TG neurons. After application of U01261μM, SB20358010μM,30μM and10μM, SP60012510μM and LY29400210μM for2mins respectively, U0126and SB203580increased the BKca currents on the ION-CCI TG neurons, while LY294002and SP600125have no effect on the BKca currents on the ION-CCI TG neurons.3. Conclusions3.1Compared with those in sham rats, the expressions of BKca in TG and TNC of ION-CCI rats are significantly decreased, and the facial mechanical pain threshold in ION-CCI rats are significantly decreased.The BKca channel agonist NS1619could increase the facial mechanical pain threshold in response to the von Frey hair filaments in ION-CCI rats.3.2The ERK antagonist U0126and p38antagonist SB203580increase the BKca currents in the ION-CCI TG neurons, and increase the facial mechanical pain threshold in response to the von Frey hair filaments in ION-CCI rats.The downregulation of BKca expression in TG and TNC, which induces hypersensitivity of TG and TNC neurons, is probably involved in the hyperalgesia and allodynia in ION-CCI rats. The underlying mechanisms could involve the phosphorylation of BKca by ERK and p38signaling pathways.