Font Size: a A A

Sequence Mitochondria Gene Cytb Of Pagumogonimus Skrjabini、and Cytb Expression In Different Stage

Posted on:2013-03-06Degree:MasterType:Thesis
Country:ChinaCandidate:M WangFull Text:PDF
GTID:2234330374992557Subject:Immunology
Abstract/Summary:PDF Full Text Request
Abstract:Objective:Attain the gene sequence of cytb and study the expression of cytb in5stages, then analyse the study’s meaning. Methods:(1) The mRNA of metacercaria、 larva-30d、larva-60d adult and egg of P. skrjabini were reverse transcripted into cDNA.(2) Design the degenerate primer of cytb of P.skrjabini use the Schistosoma japonicum’s cytb and Attain the total DNA of metacercaria of P. skrjabini. Then get the gene of cytb of P. skrjabini and design the specific primer.(3) Analyse the genetic relationship of7species flukes use their cytb genes by method NJ and MP.(4) The expression of cytb in the5stages were analyzed by RQT-PCR.. Results:(1) Achieve542bp long gene segment of cytb of P. skrjabini and design the specific primer CytbF:5’GGTTGCTTGATCATAACATTGG3’CytbR:5’ GACACTCTGGGTCGACCTTG5’(2)We find that there are7species flukes have genetic relationship, for example Schistosoma japonicum and Paragonimus westermani and so on. And then we analyse the genetic relationship of7species flukes use their cytb genes by method NJ and MP, and contrast their sequences by the software mothod Clusterx, and the results are alike in the main.(3)The result of realtime PCR is that cytb gene express at all stages except for egg stage Conclusion:(1) According to cytb genes of flukes.we can analyse the genetic relationship of flukes.(2)It is positive correlation that cytb gene express at the stages Which infract body badly.
Keywords/Search Tags:Pagumogonimus skrjabini, mitochondriagene, PCR, RT-PCR, DNAsis, Realtime PCR, clone of T/A
PDF Full Text Request
Related items