Font Size: a A A

Expression Of The Androgen Receptor Gene Cag Polymorphism And Androgen Levels In Acne Patients

Posted on:2008-09-11Degree:MasterType:Thesis
Country:ChinaCandidate:W LiangFull Text:PDF
GTID:2204360218456911Subject:Traditional Chinese Medicine
Abstract/Summary:PDF Full Text Request
Objective:Based on the experiments of immunology and molecular biochemistry thispaper deals with the relativity of the level of Testosterone and the CAGpoly; morphisms of androgen receptor geneof the patients with acne amd syndromedifferentiation and typing of TCM, thus finds the microcosmic theoreticalbasis for the TCM treatment of ache and its clinical syndrome differentiation,and the reliable evidence for the judgment of the prognosis of the patientsand active therapy of TCM and Western medicine, to some extent it providesrealistic theoretical basis for the application of the TCM syndromedifferentiation and the disease differentiation of the therapy of TCM andWestern. medicine in this field.Methods:The cases are all the acne patients in the acne specialized subjectof the dermatology section in the First Hospital of Wuhan in Hubei Province.All the patients fill the case forms which are numbered. According to tlhesyndrome differentiation of TCM we collect 30 cases of acne patients withLiver-qi Depression and 30 cases of patients with retention of sputum-mosistin the interior.All the testers are exsanguinated the blood 5ml from the outer veins,heparin anticoagulant, spin the tubes at 3000r/min for Smin, isolation bloodserunn 1.5ml into Eppendorf test tube, and put it in the refrigerator in-30℃for testing. For the female testers we exsanguinate their blood before 5-9 days of emmenia, and avoid the emmenia and ovulation period. We test theT(ng/ml) and FT (pg/ml) level of the blood serum.We select 30 normal people, 30 samples of patients with Liver-qi Depressionand 30 samples of patients with retention of sputum-mosist in the interior,then isolation the outer vein blood of 1.5ml of the above-mentionedpatients, EDTA anticoagulant, and isolation the DNA of the outer vein blood leucocyte as the template.Then weselect outer primers ARS 5' CTTTCCAGAATCTGTTCCAGAGCGTGC 3'; ARA5'G GCT GTG AAG GTT GCT GTT CCT CAT3' to amplificate the microsatellitefragments of the CAG of the androgen receptor gene (reaction system of PCRis, including 25mmol/L DNTP 2ul, 10×Buffer 5ul, 1.5mmol/L Mg3+3ul, 100pmol/Lprimer every 0.25ul, 5U/ul Taq DNA polymerise 0.3u1, H20 34.2ul, template DNA5ul;PCR program: 95℃beforehand denaturation 2 min. Then into thecycle, 94℃denaturation 30s, 58℃annealing 30s, prolongation 60s of 72℃, cycling 35times), at last prolongation 10min of 72℃, and theamplification fragments are about 280bp. 1.5%gelose gelectrophoresis,and we get the evidence of the PCR outcome under the ultraviolet radiationlamp. We analyze it under the gel image system, and record the data with opticalphotography, then send the PeR outcome of the30random samples of the patientswith Liver-qi Depression and 30 random samples of the patients with retentionof sputum-mosist in the interior to Beijin Biological Technology Co. Ltd fortesting with the primer (ARS 5' CTTTCCAGAATCTGTTCCAGAGCGTGC 3'). The resultof the testing using Chromas to analyze.Result:1 The Testosterone of sputum-mosist person in the interior and the FreeTestosterone of Liver-qi Depression are both higher than the adult. Thedifference has height significance(p<0.01).2 The length of the androgen acceptor gene CAG fragment of ache sufferer isshoter than it of normal. The difference has significance(p<0.05).3 The length of the androgen acceptor gene CAG fragment of Liver-qi Depressionperson is shoter than the normal, The difference has significance(p<0.05).The length of the androgen acceptor gene CAG fragment of Liver-qi Depressionperson is shoter than it of sputum-mosist person, The difference hassignificance(p<0.05).4 The length of the androgen acceptor gene CAG fragment of acne sufferers does' t has correlation with clinical symptom, It does't has significance (p>0.05).
Keywords/Search Tags:Testosterone, Free Testosterone, Androgen receptor, CAG polymorphisms of gene, Acne, Phenotypes of differential diagnosis in TCM
PDF Full Text Request
Related items