Level Of T-bet, Gata3 And Foxp3 Mrna Expression On The Peripheral Blood Mononuclear Cells Of Patients With Systemic Lupus Erythematosus And Its Significance

Systemic lupus erythematosus(SLE) is an autoimmune connective tissue disease characterized by the deposition of immune complexes with an inflamematory/necrotic phenomenon in different tissue,mainly skin,kidney,joints,central nervous system, blood systems,and other organs,which lead to the damage of the multi-organs.The complexity of the pathogenesis of SLE has not yet fully clarified.Study shows that in recent years,the imbalance of T cell subsets and cytokine network exists in patients with SLE,however,there is no agreement with the role of lymphocyte subsets in the pathogenesis of SLE.Auxiliary T cell 1(Th1),auxiliary T cell 2(Th2) and the "CD4⁺CD25⁺Treg" can be on behalf of a complex cytokine network in the body,which can used as the evaluation of the whole of the immune status,the mutual balance of Th1,Th2 and Treg plays a key role in the the immune response,and in regulation and differentiation of T cell subsets,the transcription factor has an important regulatory role.The expression of transcription factor T-bet, GATA3 and FOXP3 were specific to the Th1,Th2 and CD4⁺CD25⁺Treg.It has been few report about T-bet,GATA3 and FOXP3 in SLE now.To further explore the effects of T-bet,GATA3 and FOXP3 in the pathogenesis of SLE,we detected the mRNA expression levels of T-bet,GATA3 and FOXP3 in peripheral blood mononuclear cells(PBMCs) of patients with SLE,and compared with the normal crowd.Materials and methodsclinical dataEighty-seven cases aging ten to forty-eight years old were collected in our hospital from June 2007 to February 2008,of which ten male and seventy-seven female,with the average age of 30.5±2.7.All patients were diagnosed with the diagnostic criteria for SLE that revised by the United States Institute of Rheumatology in 1982.All the cases were division by SLE disease activity index(SLEDAI) score, kidney damage,bone damage,anti-dsDNA level and whether to accept the group before glucocorticoid treatment.The normal control group was forty-seven women aging twenty-two to thirty-eight years old,with an average age of 27.3±2.2.1.Laboratory studies(1) RNA extraction:separated PBMCs from 2 ml peripheral venous blood of the patients and controls by density gradient centrifugation,extracted the total RNA,and determined the purity of RNA with spectrophotometer of A260/A280 ratio.(2) Reversed transcription the RNA to cDNA.The conditions(10μl system):37℃15 min,85℃5 s.(3) According toβ-actin,T-bet,GATA3 and FOXP3 gene sequence designed the specific rimers.β-actin primer:Fw5'CATGTACGTTGCTATCCAGGC3', Rv5'CTCCTTAATGTCACGCACGAT3',amplified 250 bp;T-bet primer:Fw5' CAAGGGGGCGTCCAACAAT3';Rv5'TCTGGCTCTCCGTCGTTCA3';Rv5' GGTGGTCTGACAGTTCGCAC3',amplified 102 bp;GATA3 primer:Fw5' TCACAAAATGAACGGACAGAACC3';Rv5'GGTGGTCTGACAGTTCGCAC3', amplified 100 bp.xp3 primer:Fw5'CTGCCCCTAGTCATGGTGG3';Rv5'CTGGA GGAGTGCCTGTAAGTG3',amplified 72 bp;(4) General PCR reaction:the conditions:95℃3 min;95℃30 s,55℃30 s,72℃60 s,35 cycles;72℃5 min.(5) Agarose gelelectrophoresis.To determine whether the products were amplified by the fragment.(4) SYBR Greenâ… fluorescence quantitative PCR reaction:detected T-bet,GATA3 and FOXP3 mRNA expression,regardingβ-actin as the internal reference,were.Conditions(20μl system):predegenerated 95℃10 s,1 cycles;PCR reaction 95℃5 s,60℃30 s,40 cycles.(5) PCR product analysis:analysis the melting curve of PCR products,authenticate theβ-actin,T-bet,GATA3 and FOXP3 at the same amplification efficiency.2.Stastistical analysisEach specimen of SYBR Greenâ… fluorescence quantitative PCR reaction was repeated the three,from an average of CT value.The same gene amplified by the different CT values were marked as CT_β-actin,CT_T-bet,CT_GATA3and CT_FOXP3,calculatedΔCT_{target gene}=CT_{target gene}-CT_β-actin and getΔCT_T-bet,ΔCT_GATA3,andΔCT_FOXP3.ΔΔCT =ΔCT_{experimental group}-ΔCT_{control group},the difference multiplier=2^{-ΔΔCT}.Analyze the mRNA expression of each group of the relative changes using 2^{-ΔΔCT}.Results1.The levels of GATA3 mRNA in patients with SLE was 0.74 times to control group,and the levels of T-bet and FOXP3 mRNA was no significant difference between the control gronp and patients.And the level of FOXP3 expression was negatively correlated with SLEDAI.2.The levels of GATA3 mRNA in active group were 0.42 times to control group, and the levels of GATA3 mRNA in inactive group was 0.37 times to control group. And the levels of T-bet and FOXP3 mRNA were no significant difference between the three groups.3 The levels of GATA3 mRNA in the kidney-damaged group were 0.52 times to control group,and the levels of GATA3 mRNA in no kidney-damaged group was 0.32 times to control group.And the levels of T-bet and FOXP3 mRNA were no significant difference between the three groups.4.The levels of GATA3 mRNA in the joint-damaged group were 0.48 times to control group,and the levels of GATA3 mRNA in no joint-damaged group was 0.33 times to control group,the levels of FOXP3 mRNA in no joint-damaged group was 2.11 times to the joint-damaged group.And the levels of T-bet mRNA were no significant difference between the three groups. 5.The levels of GATA3 mRNA in untreated group were 0.33 times to control group,and after the treatment,the levels of GATA3 mRNA in patients was lower than the control group.And the levels of FOXP3 mRNA in untreated group was 0.54 times to control group,while after the treatment,the levels was no significant difference between the two groups.And the levels of T-bet mRNA were no significant difference between the three groups.6.The levels of GATA3 mRNA in the dsDNA(+) group was 0.51 times to control group,and the levels of GATA3 mRNA in dsDNA(-) group was 0.45 times to control group.And the levels of T-bet and FOXP3 mRNA were no significant difference between the three groups.7.The levels of T-bet/GATA3 mRNA in SLE group were higher than control group.The levels in no kidney-damaged group,no joint-damaged group and dsDNA(-) group were as higher than the kidney-damaged group,the joint-damaged group and dsDNA(+) group.Conclusions1.The levels of GATA3 mRNA in patients with SLE was lower than control group,and the ratio of T-bet/GATA3 in active group was higher than inactive and control group,which demonstrated that the transforming factors of T-bet and GATA3 may involved in the incidence of SLE and the model of T-bet/GATA3 may played a role in the progress of SLE.2.The level of FOXP3 expression was negatively correlated with SLEDAI,which suggested the expressment of the FOXP3 was significant correlated with the activement of SLE.3.Before the treatment the levels of T-bet/GATA3 mRNA in SLE group was higher than control group,but the levels was no significant difference between the three groups.So the ratio of T-bet/GATA3 could be used as one of the effective treatment indicators with glucocorticoids.4.The levels of FOXP3 mRNA in untreated group was significantly lower than control group,while after the treatment,the levels was no significant difference between the two groups,which demonstrated the conversion of FOXP3 gene-induced Treg cells to non-natural Treg cells in vitro may be possible to be a new strategy for the treatment of SLE.