BackgroundErythropoiesis is a multi-step process involving commitment, proliferation, and differentiation of hematopoietic progenitors to mature, terminally differentiated erythrocytes. Normal erythropoiesis is regulated by a complex interplay of different cytokines and growth factors that act on stem cells or early progenitors at various stages. By interacting with their own cell surface receptors, cytokines or growth factors initiate signals transduced from the plasma membrane into the nucleus to promote selective activation and/or repression of genes. Thus, alterations in the transmission of the signalling cascade lead to abnormal erythropoiesis. Overall, Signal transductions via C-Kit/SCF and EPO/EPO receptor indicate a critical role in erythropoiesis. Abnormality of c-kit signalling has been assosicated with leukemia, MDS, multiple myeloma (MM), whereas the disruption of epo signalling tranduction is involved in hematopoietic malignancies, aplastic anemia (AA), polycythemia vera (PV) and MDS [1,2]. Detailed investigation of cellular signal transductions involved in normal and abnormal erythropoiesis could be valuable in understanding the regulation of erythropoiesis, molecular events of hemopoietic malignancies and exploring potential agent for treating these malignancies. In 2000,Ye indentified a new murine cell surface molecule on the erythroid cells, namely ermap (erythroid membrane associated protein) .In 2001,Su screened human ermap (hermap)from human fetal liver cDNA library,and Xu also screened it from a subtractive cDNA library constructed from a 10-week and a 22-week human fetal liver.ERMAP is a transmembrane protein of 476 amino acids. It belongs to the immunoglobulin superfamily(Ig-SF),with one IgV fold in its extracellular segment. The IgV fold at the N-terminus of ERMAP shares strong homology not only with structures of Ig-like domain,but also with that of Ig-like fold domain. Ig-like domain exicts in serine/threonine protein kinase,signaling lymphocyte activation molecule(SLAM) and receptor tyrosine kinase(RTK). Ig-like fold domain resides in CD3 complex,and transmembrane tyrosine kinase receptor. Several of these proteins mentioned above are thought to function as cellular signal transduction. In addition, IgV fold is also homologious with myelin/oligodendrocyte glycoprotein (MOG), which contains a recognized sequences for C1q,the first component of the complement cascade. The cytoplasmic region of ERMAP contains a B30.2 motif,which shows a high homology with two families of proteins,the butyrophilin and SPRY family. The function of SPRY is still unknown. Based on the involvement of SPRY family in regulating the activation of Ca2+ channel mediated by inositol triphosphate receptor as well as protein-protein interactions,it is strongly suggested that ERMAP,through its B30.2,binds to downstream components of cell signalling pathways. Nevertheless,ERMAP contains several motifs implicated in intercellular signals. These motifs include phosphorylation structural domain,SH3 binding structural domain,and di-leucine structural domain.Our previous data demonstrated the transcriptional profile of hermap is associated with lineage-specific differentiation of human erythropoiesis:①Analysis of hermap expression in 15 different cell types of normal,somatic and hemotopoietic origins indicated hermap expressed in K562,HEL and ECV304 cell lines,as well as in hemotopoietic tissues of fatal liver and bone marrow.②An examination of the various fetal tissues of 25+5-week has demonstrated hermap expression in liver and bone marrow. Hermap remained expressed in 9~36 week fetal livers. Its expression increased from 12-week,peaking in 18~20 week followed by a decline and subsequently kept a stable and low level. In human fetal bone marrow,hermap mRNA began to express from 15-week and reached a highest level in 27~32 week, and fell rapidly from 33 week.③Expression of hermap mRNA during erythroid differentiation of K562 cells:the level of hermap mRNA increased when K562 cells differentiated into erythroid cells induced by Ara-C,however unchanged while K562 cells differentiated into macrophages by TPA.④Expression of hermap mRNA during umbilical cord blood cells differentiation towards erythroid lineage: hermap expression level increased while umbilical cord blood cells differentiated into erythroid cells in the presence of SCF,IL -3 and EPO.In conclusion, hermap codes an erythroid transmembrane protein that belongs to immunoglobulin superfamily. The high restricted expression of hermap in hemotopoietic systems strongly suggests its essential role in differentiation/maturation of erythroid cells. Additional,Human ERMAP is likely to be involved in migration of erythroid cells to liver and bone marrow during fetal developmental stages. However, which potential role does hermap play in the physiology and pathology of erythropoiesis?Which factors are correlated with the interaction of hermap in erythroid differentiation?All these remain to be further investigated.ObjectiveTo investigate the potential role of hermap in cellular signal transduction during erythroid differentiation of K562 cells induced by Ara-C.Methods1.Construction of pEGFP-C1-hermap and hermap-siRNA-pRNAT plasmids1.1 Construction of pEGFP-C1-hermap:The inserted full length sequence for hermap coding region was PCR amplified using the forward primer 5'>TATGGATCCATGGAGATGGCGAGTTCT<3'and the reverse primer5'> CGCGATATCAAAAGAAGGAGCCTTGAGC<3'. The PCR product was then digested,isolated and subcloned into pEGFP-C1 at the Bgl II and SmaI sites of the multiple cloning sites.1.2 Construction of hermap-siRNA-pRNAT plasmids:The two siRNA double- stranded oligonucleotides designed against hermap were as followed: hermap siRNA: Sense 5'-GATCCGGTGAACTCTTCTTTACTATTCAAGAGATAGTAAAGAAGA GTTCACCTTA-3'. Each oligonucleotide pair was anealed by incubation at 100℃for 5 minutes and slow cooling. Two microliter of the mixture was then ligated into sites BamHI and HindⅢon the pRNAT-H1.1/Neo plasmid vector. 2.Establishment of hermap over-expressed and hermap siRNA stable-transfected K562 cells : pEGFP-C1-hermap and hermap-siRNA-pRNAT plasmids were transfected into K562 cells. Hermap over-expressed K562 cells and hermap siRNA stable-transfected K562 cells were obtained by G418 selection.3.After hermap over-expressed K562 cells and hermap siRNA stable-transfected K562 cells were treated with Ara-C(10-5mM) for the indicated times,the level of hermap mRNA,cell morphology,biphenylamine staining,and the percentage of CD235a+/CD36-,CD235a+/CD36+ and CD235a-/CD36+ cells were analysed by FQ-PCR and flow cytometry,respectively.4.After hermap over-expressed K562 cells and hermap siRNA stable-transfected K562 cells were treated with Ara-C(10-5mM) for the indicated times,expressions of p-STAT5,p-Akt,p-MAPK and p-c-Jun were examined by flow cytometry as well as the correlation with the level of hermap mRNA was assessed.Results1.Verification of hermap-pEGFP and hermap-siRNA-pRNAT plasmids. Identification by enzyme cutting and sequencing showed that hermap-pEGFP and hermap-siRNA-pRNAT plasmids were constructed successfully.2.Obtainment of hermap-overexpressed transfected K562 cells and hermap-siRNA stable-transfected K562 cells Hermap over-expressed transfected K562 cells and hermap-siRNA stable-transfected K562 cells were obtained by G418 screening and verificated by observation of GFP expression under fluorescence microscope.3 . Upregulation of hermap expression promoted erythroid differentiation/ maturation , while inactivation of hermap blocked erythroid differentiation/ maturation.Changes of cell phenotype of K562 cells induced by Ara-C were depicted as followed:①Morphological changes of K562 cells:Cells became small morphologically,as well as a low nucleus to cytoplasm ration,then the cells appeared with highly condensed nuclei and an increasing pink cytoplasm.The morphological changes of K562 cells indicated development of maturation along erythroid lineage from an early, intermediated to late-stage cells.②Biphenylamine staining : In hermap-pEGFP transfected group , Ara-C treatment led to an increasement of biphenylamine staining in a time-dependent manner (p<0.05,vs other groups).In hermap-siRNA stable-transfected group,the rate of biphenylamine staining was progressively enhancing from 48hrs to 96hrs after Ara-C treatment,however,the positive rate of biphenylamine staining was lower than that observed at other groups at each indicated times(p<0.05,vs other groups).③The percentage of CD235a+/CD36-, CD235a+/CD36+ and CD235a-/CD36+:Flow cytometry analysis showed that a gradual increasement of percentage of CD235a+/CD36- ,CD235a+/CD36+ as well as CD235a-/CD36+ cells in response to Ara-C from 24hrs to 96hrs in all the 4 groups.And this percentage is highest in hermap-pEGFP transfected group, whereas lowest in hermap-siRNA stable-transfected group at each indicated time.④Aγand Gγexpression profiles:In hermap-pEGFP transfected group,Aγexpression increased from 24hrs to 96hrs after Ara-C treatment (p<0.05).The levels of Aγexpression was relative high at each indicated time in hermap-pEGFP transfected group compared to other groups(p<0.05).Gγexpression remained constant until 24hrs,where it began to progressively increase from 48hrs to 96 hrs after Ara-C treatment(p<0.05).In hermap-siRNA group,Aγexpression remained steady until 48hrs where expression increased gradually through 96hrs.At the two time points of 48-hrs and 96-hrs,the levels of Aγexpression were lower in hermap-siRNA group than other groups after Ara-C treatment(p<0.05).Gγexpression remained elevated through the cultures times.⑤Relationship of hermap expression with phosphorylation of STAT5,AKT,MAPK and c-Jun;The percentage of p-STAT5+ cells increased progressively after Ara-C treatment in all 4 groups.It showed that there was a good positive correlation between the population of p-STAT5+ cells and level of hermap expression in hermap-pEGFP transfected group , but not in other 3 groups(p>0.05) . In hermap-pEGFP transfected group,Ara-C induced an increasement of percentage of p-c-Jun+ cells, which was coincided with expression of hermap. Otherwise,No correlation was observed between percentage of p-c-Jun+ cells and expression of hermap in other 3 groups.In hermap-siRNA group, percentage of p-c-Jun+ cells was highest at 24-hrs and values decreased in a time-dependent manner,which was found to be negatively correlated with expression of hermap.Percentage of p-c-Jun+ cells were higher at each time point in hermap-siRNA group than in other 3 groups.No correlation between the percentage of p-MAPK+ or p-Akt+ cells and hermap expression(p>0.05).Conclusions1.Hermap-pEGFP and hermap-siRNA-pRNAT expressing plasmids were cons- tructed successfully . Hermap-over expressed transfected K562 cells and hermap-siRNA stable-transfected K562 cells were obtained.2.Upregulation of hermap expression promotes erythroid differentiation/maturation of K562 cells induced by Ara-C,while inactivation of hermap blocked this process, which implicate that hermap is closely related to human erythroid differentiation/ maturation.3.Hermap promotes erythroid differentiation/maturation via the activation of JAK/STAT5 pathway.However,which is the upstream potential component correlated with the interaction of hermap in JAK/STAT5 pathway?and what is the mechanisms of the interaction between hermap and its interacting partner? All these make hermap remains as an interesting candidate gene for further investigated. |