IntroductionArbovirus is a category of viruses that spread between human and lives tocks by hematophagus stinging.Therefore,the virus could cause a kind of zoonosis.Up to now, about 537 arboviruses were found in the world and more than one hundred and thirty of them could induce zoonosis.It has become a serious worldwide public health problem. In addition,with the increase of international communication,the chance of arbovirus coming into our country from abroad would be elevated significantly.So,it is very important to detect the infection of arboviruses simultaneously,quickly,and accurately.Multiple RT-PCR(M-RT-PCR) is developed on the basis of the general RT-PCR. In the reaction system of M-RT-PCR,two pairs or more primers were added,and the target genes were amplified at the same time.M-RT-PCR can not only detect multiple pathogens simultaneously,but also maintain the ordinary high sensitivity and specificity of RT-PCR and reduce the consumption of experimental templates,labor, financial resources,and time.The object of the present study was to detect the Japanese encephalitis virus(JEV), yellow fever virus(YFV),West Nile virus(WNV) and St Louis encephalitis virus (SLEV) with the multiplex RT-PCR method after the specific primers of them had been designed.The objective of the study was to establish the method of M-RT-PCR for detection four kinds of arboviruses initially.It would provide a method to diagnose the single or mixture virus taking along with mosquito fast,accurately,and reliablly;offer a reliable and effective method to detect the arboviruses;offer an effective and quick way to screen in a large-scale of border crossings and to detect the common mosquito in epidemiology. Materials and Methods1.Design of primersAccording to the whole gene sequences of JEV,YFV,WNV,and SLEV published in the GeneBank,the consensus sequences of the four viruses were found with DNAStar software.At last,the four pairs of specific primers were designed with the Primer Premier 5 on the basis of the consensus sequences.2.Determination of JEV and YFV virus titerIn the experiment,JEV and YEV were attenuated live vaccine of SA-14-14-2 and 17D respectively.When the affection occurred in more than 80%virus of the cultured BHK 21 cell,the virus would be harvested.The virus solution was cultured in 96-well culture plate after dilution.Then TCID50 was calculated with the method of Reed-Muench3.Transcription of pNV-prM and pSLEV-CprM in vitro and calculation of RNA copy numbersThe DN A was made to be linear by cleaving with single enzyme.According to the introduction of the kit,the transcription in vitro was operated.Finally,the plasmid copy numbers were calculated after the determination of RNA quality and concentration.4.Establishment of single RT-PCR for the four kinds of arbovirousesThe cDNA of the arbovirouses was obtained by reverse transcription(RT).Further, the polymerase chain reaction(PCR) was taken with the template of cDNA. Determination PCR specificity:the mixed virus template was detected by single primer, and the single virus template was measured by mixed primer.Determination PCR sensitivity:the mRNA of JEV and YFV was extracted in each virus solution,which was diluted by multiproportion.Meanwhile,the RNA of normal cells,which were added into RNA of WNA and SLEV recombination plasmid after transcription in vitro,was extiacted.Then RT-PCR would be carried out. 5.Initial establishment of M-RT-PCR and optimization of reaction conditionEqual volume of each virus template with the appropriate dilution degree was mixed,and that of primers were added into.The reaction condition of muliplex RT-PCR was the same as single RT-PCR.According to the result of electrophoresis, primer levels,Mg2+ concentration,and annealing temperature would be optimized.Results1.Design of specific primersThe primers had good representativeness after comparison of the sequence,and there was high homology between the amplification sequence of the primer and other virus.It suggested that the design of primer was feasible.The primers of JEV,YFV, WNV,and SLEV were as follow:JS3-1F:AGAGCGGGGAAAAAGGTCAT,JS3-IR: TTTCACGCTCTTTCTACAGT,YFE-4F:CTTACAGCGGCAATCAA,YFE-4R:AGG CAGAGCCAAACACC,WNM-1F:AGGTGATGATGACGGTAAAT,WNM-1R:AA GCAATAGCACGACAAACA,SLCM-1F:TAGCCATCCTGACATTCTTC,SLCM-1R: TGTGTGTTGTTGCTGCCTA.2.The calculated results of titers and copy number of virusThe titers of JEV and YEV were 1.6×106PFU/ml and 4.4×105 PFU/ml respectively after statistical analysis and formula calculation.The copy number of WNV-M and SLEV-CM plasmids were 2.10×1015/ml and 6.22×1015/ml after determination of plasmids concentration by UV spectrophotometer and the calculation on plasmids molecular weight.3.Single RT-PCR for the four kinds of arbovirousesIt was found that the specificity of the primers was favorable after the experiment. The lowest detection titers of JEV and YFV were 1.6×106 PFU/ml and 4.4×105 PFU/ml respectively.The lowest detection copy numbers of WNV-M and SLEV-CM are 2.10×103/ml and 3.11×104/ml separately.4.Initial establishment of M-RT-PCR and optimization of reaction conditionAfter the optimization of reaction condition,the best condition of M-RT-PCR was as follow:the primers concentration of JEV and SLEV was 0.5μM and that of YFV and WNV was 1μM;annealing temperature was 49.4℃;the level of Mg2+ was 3mM;the concentration of dNTP was 250μM.Conclusions1.Four pairs of specific primers of JEV,YFV,WNV,and SLEV were designed for M-RT-PCR;2.The methods of single RT-PCR about JEV,YFV,WNV,and SLEV had been established;3.The RNA of WNV and SLEV,which was prepared by transcription in vitro,was microgram class;4.The methods of M-RT-PCR for identification of JEV,YFV,WNV, and SLEV had been established initially. |