The Effect Of TGF-β₂ ASON To The Repair Of Injury Rabbit Cornea

Objective and significanceOcular trauma is common in clinic. As locating anterior extremity of the ocular and exposing in the palpebral fissure , cornea is easy to suffer from trauma and thus its transparency and regulation of surface are destroyed,so astigmatism emerged and disturbed visual function as scar formed during corneal wound healing. Sometimes the astigmatism is difficult to correct by spectacles or excimer laser.Repair of post-traumatic corneal wound is a series of cascade processes,including fibroblastic activation proliferation differentiation, release of cell factors, synthesis and rebuilding of extracellular matrix,etc.The rehabilitation is the result of various cells and cell factors coordination in space and time.More and more researchs manifested that TGF-βplay an important role in organism wound healing. Among them ,TGF-β₂ is the initiator of corneal wounds repair,it is feasible to controll the repair procedure by regulating the actaviting of TGF-β₂.In the study,we made models of corneal perforating injuries with rabbits, and designed TGF-β₂ ASON to transfect the scars tissue of post-sutura corneal perforation,then observed and analysised the changes in morphous histio-structure cell protein quantities and gene expression by the techniques of slitlamp observation HE staining immunohistochemistory and real-time PCR, to reveal influence of TGF-β₂ ASON to TGF-β₂ actaviting in corneal injuries rehabilition. The results provided theory base for the presumption of reducing corneal scars formation by drugs.Materials and methods(1) The preparation of TGF-β₂ anti- sense oligodeoxynucleotide (TGF-β₂ ASON) reference to the sequence of TGF-β₂ mRNA (Gene bank AY429466),Shanghai Sangon biotechnology limited company synthesis a piece of ASON that is 21 bp.Its sequence is 5'- AGAAGTTGGCATTATACCCTT-3'.And they still synthesis a piece of missense oligodeoxynucleotide(MSON). Its sequence is 5'- GCGATCTGGCATTATACCCTT -3'.They put it as a control.(2) A total of 24 clearing ,healthy Newzealand rabbits, paroecious , three months old.Randomization: experiment group sixteen, their all corneas are made cornea perforating injury and then sutured.After surgery we give TGF-β₂ ASON to their left eyes as them TGF-β₂ ASON group .We give normal saline( N.S) to their right eyes as them N.S group . Eight rabbits are in control group.They did not receive operation .Samely we give TGF-β₂ ASON to their left eyes as them TGF-β₂ ASON group and N.S to their right eyes as them N.S group.Specimen: we dislodged their corneas on post-operation the 4^th ,7^th, 14^th and 28^th day.we execute six rabbits once (experimental group 4rabbits, control group 2 rabbits).(3) Slitlamp observation Histopathology Immunohistochemistry Real Time PCRResults(1) Slitlamp observation :TGF-β₂ ASON group : Bulbar conjunctiva is hyperemia slightly,The cornea is edma aroud the suture, Aqueous flare (0～+),Iris is clear.The pupil is round .IOP is normal. The inflammation released gradually and eliminated utterly postoperation 1 week. NS group : The cornea is edema apparently, Aqueous flare (+～++),Iris is blurred.　The pupil is irregular. IOP is normal. There are lots of new vessels near limbus. The inflammation released gradually and eliminated utterly postoperation 2 week. but the new vessles isn't vanished.(2) Histopathology resultsThe TGF-β₂ ASON group : Epithelial cells grow 1 - 2 layers on the post-operation 4^th day, fibroblast's body in the stroma becomes large and applanatus ,quantity increases,nine cells in the per field of high power lens .On 7^th day , epithelial cells grow 4-5 layers,arrange irregularly, fibroblasts in the stroma increase,twelve cells per field. On 14^th day ,epithelium almost becomes integrite, fibroblasts reduce,collogen fibril disposes loosely. The N.S group : epithelial cells grow 4-6 layers on the post-operation 4^th day, fibroblast's body in the stroma becomes large and applanatus ,quantity increases,twenty-one cells in the per field of high power lens. On 7^th day , epithelial cells grow 4-5 layers,arrange irregularly, fibroblasts in the stroma increase,eighteen cells per field. On 14^th day ,epithelium arrange irregularly a little , fibroblasts increase, collogen fibril disposes thickly.In the control group ,the eyes with TGF-β₂ ASON and N.S appearance concord under the high power lens .It tells us TGF-β₂ ASON is safe to normal cornea.(3) Immunohistochemistry results(1) positive fibroblasts in the N.S group climate the peak on the post-operation 4^th day after cornea trauma.And on 14^th day , there is few positive fibroblasts .In the TGF-β₂ ASON group , fibroblasts with positive a-SMA chalked the peak on the post-operation 7^th day .And it returned to the basic line on the post-operation 14^th day .As the time is gone , fibroblasts with positive a-SMA reduce gradually .On the post-operation 4^th and 7^th positive fibroblasts in the TGF-β₂ ASON group are fewer than in the N.S group and the difference is statistical significance (P <0.05).(2) Fibronectin: fibronectin stained in the TGF-β₂ ASON group is fewer and loosely distributes in the stroma layerly aroud the cornea wound .In the N.S group fibronectin thicknessly distributes.(4) Real Time PCR resultsIn the group of TGF-β₂ ASON ,the correspondent expression of TGF-β₂ in 4d, 7d, 14d, 28d is 0.0851±0.0034, 0.1371±0.0086,0.0756±0.0031,0.0660±0.0008. In the group of Inj N.S is 0.1921±0.0103 , 0.1892±0.0109, 0.1622±0.0110,0.1280±0.0135.In the same periods, the comparison of two sets has statistical significance (p<0.05).Conlusion1. TGF-β₂ ASON can specificly block the transcription and translation of TGF-β₂ and restrain the synthesis of TGF-β₂ mRNA to influence the activity of TGF-β₂, and regulate the healing prosess of injured cornea prosth ,that is restraining fibroblastic activation, ECM accumulation of collagen and fibronectin to reduce scarring .2. After sutura of injured cornea the athletic period of fibroblast migration and proliferation is 4 d - 7 d of post-operation .In the 14 d it mostly returns to the basic line .The evident restraining of TGF-β₂ ASON to fibroblast of positive a-SMA is in post-operation 14 days . So it both promotes the coenea healing and reduces scar therericly. Interventing regulation in post-operation 14 days that is in the early peoriod of cornea healing continious process.3. Real time fluorescence quantitative RT-PCR is feasible technique to examine the gene expression of rabbit cornea its cell is microamount. It is high specific ,accur quantitate ,reliability results and repeatable.