| The effect of RNA interference to the excretion of TNF-αin mice activated peritoneal macrophagesObjectiveTumor necrosis factor alpha(TNF-α,a pleiotropic cytokine,triggers physiological and pathological responses in several organs.The TNF-αgene is located on chromosome 6p21,3 and is mainly expressed by activated macrophages,NK cells and T-lymptocytes,even though other cell types(e.g. fibro blasts,kupffer cells, smooth- muscle cells,and tumor cells) have been shown to express it.More than any other cytokine TNF-αis central to the initiation and orchestration of inflammation.Excessive or prolonged release of TNF-αunderlies many human diseases.TNF-αhas been reported to respresent one of the main factors responsible for neoplastic cachexia and other severe clinical disasters such as septic shock and respiratory distress.Although the pathophysiological importance of TNF-αis well illustrated by the success of anti-inflammatory therapies that rely on binding to and inactivating this cytokine,limitations in current therapies still remain.So it is critical for developing novel therapies to control TNF-α.Modern therapeutic methods for manipulation of gene expression in TNF-αrelated diseases have been receiving increased attention in the emerging era of functional genomics.RNA interference (RNAi) implies a more rational therapeutic agent for many diseases.RNAi is an evolutionarily conserved process that functions to inhibit gene expression.The introduction of double-stranded RNA(dsRNA) into a range of organisms induces both a potent and specific post-transcriptional gene silencing effect by directing degradation of homologous target RNAs, which is mediated by siRNA.Recent studies have shown shRNA could specially silence some cytokine of primary immunocyte.However, shRNA has not been used in TNF-αof mice activated peritoneal macrophages yet. In this study, we desigen special shRNAs targeting TNF-αmRNA,use silentGene-2U6 Hairpin cloning Systems to compound SCEs(siRNA expression cassettes) to induce RNAi.We select 2 target sites from TNF-αgene sequence and synthesize shRNA to inhibit target gene expression. The lecture will discuss the RNAi of site 1.Methods1. Peritoneal macrophages collection and clture:C57BL/6 mouse, male(provided by China Medical University animal department).Sacrifice a mouse, sink the mouse in the 75% alcohol for 5min. In sterile environment, inject i.p.4ml Hank's liquid,gently massage the anterior and lateral walls of the abdomen.Dissect the tissues and open the peritoneum cavity.Accurately collect the peritoneum washes into a centrifuge tube,centrifuge at 4℃,1000rpm,for 7min.Adjust the concentration of counted cells as 2×10~6/ml with DEME,finally inoculate in 6 hole culture plate.2. Ability of peritoneal macrophage to excrete TNF-α:After cell's normal growth,add 10μg/mlLPS to stimulate peritoneal macrophage, 10μl for each hole.Collect the cell culture upper liquid at 2h,6h,10h,14h after stimulation.Use ELISA method to assay the concentration of TNF-α.3. Cell's dividing and treatment:Three groups:Interference group:add shRNA expression carrier aiming at target site 1 from TNF-αgene sequence.Positive-control group:add siRNA expression carrier aiming at IL-1 gene sequence.Negative-control group:add normal DMEM culture liquid.For each group,collect the cell culture upper liquid to assay the concentration of TNF-αand IL-1 with ELISA.4. Prepare siRNA expression cassettes of RNA interference group and positive-control group:Find TNF-αand IL-1 gene sequence of C57BL/6 mice from GeneBank.Use the target sequence selection software and principle provided by Promega and select target sites.Next synthesis PCR reaction synthesize siRNA expression cassettes.After purification,2% agarose gel electrophoresis detect DNA. 5. Assay the specificity of RNAi action:lL-1 is an important cytokine macrophages excrete.Use IL-1 is an positive-control which is inhibited.This can prove specificity of RNAi.6. Assay mRNA of TNF-α:collect the cell,abstract RNA.Use RT-PCR assay the mRNA of TNF-α.7. Detect cytokine:collect the cell culture upper liquid to assay the concentration of TNF-αand IL-1 with ELISA.Results1. LPS stimulate peritoneal macrophage to excrete TNF-α:The concentration of TNF-αreached the top point at 6hours stimulation.2. Prepare siRNA expression cassettes of RNAi group and positive-control group: Down stream primer of RNAi group: 5'ATCTAAAAAGAGCACAGAAAGCATGATCAGAGAACTTGATCATGCTTTCTGTGCTC GGTGTTTCGTCCTTTCCACAAGA3' Downstream primer of positive-control group: 5'ATCTAAAAAGCAAGCTATGGCTCATTCAGAGAACTTGAATGAGCCATAGCTTGCGGTGTTTCGTCCTTTCCACAAGA3'3. RNAi effect the concentration of TNF-α:ELISA result means that the concentration of TNF-αin interference group is obviously lower than in negative-control group(P<0.05) and in positive-control group(P<0.05).4. The specificity of RNAi action:ELISA result means that the concentration of IL-1 in positive-control group is obviously lower than in interference group(P<0.05) and negative-control group(P<0.05).5. RNAi effect the mRNA level of TNF-α:The amount of TNF-αmRNA in interference group is obviously lower than in negative-control group (P<0.05) and in positive-control group(P<0.05).Conclusions1. RNAi technique can interfere the mice peritoneal macrophage to express TNF-α mRNA and excrete TNF-α.2. RNAi has strict sequence specificity.3. The shRNA of site 1 can specifically inhibit the excretion of TNF-α,so we can select this site as sensitive target site for the later experiment.In a word, RNAi specifically inhibit the expression of cytokine TNF-α.It promotes the application of RNAi technique in mammal cells and opens up a new way to the gene therapy of TNF-α. |