Font Size: a A A

Expression Of Glutamate Transporters GLAST MRNA And Protein In Hippocampus Of Spontaneously Epileptic Rats

Posted on:2007-10-06Degree:MasterType:Thesis
Country:ChinaCandidate:D Y TuFull Text:PDF
GTID:2144360182992163Subject:Pharmacology
Abstract/Summary:PDF Full Text Request
IntroductionEpilepsy is a common ailment, and the disease incidence is about 0. 5% in the world. Most of epilepsy is hereditary, and the heredity mode is very multiplicity. Glutamate and asparate is the very important neurotransmitters in the mammalian central nervous system. Increased extracellular glutamate concentrations have been found within the epilepic brain,both immediately preceding the seizure and during seizure activity itself. Glutamatergic neurotransmission is terminated by glutamate uptake from the synaptic cleft into neurons and surrounding glial cells by glutamate transporters. There have been cloned five types of such transporters, GLAST is one of them. In vivo and in vitro studies suggest GLAST are crucial in maintaining low resting extracellular glutamate levels. But to date, the mechanism of GLAST in hereditary epilepsy is unclear . The present study therefore investigated the GLAST mRNA and protein in hippocampus of spontaneously epileptic rats by RT - PCR and immumohistochemistry.Methods1. Sieve SER by DNA extraction and PCR.2. Total RNA extraction with Trizol reagent.3. GLAST gene was amplified by RT - PCR. All procedures of RT - PCR reactionwere implemented according to the illustration of PCR kit. GLAST was amplifiedwith the primers: 5 - ATGACAAAAAGCAACGGAGAA - 3 ' and 5 ' -ATCTGCGGCAGTCACCTGCACGAT-3' GAPDH primers: 5'-AATGCATC-CTGCACCACCAA -3';and 5' —GTAGCCATATTCATTGTCATA— 3:4. Immunohistochemistry was used to study the expression of GLAST protein.5. the data were evaluated by t -test.Results1. The PCR product is 197bp. we sieve the SER successfully.2. OD260/OD280 of the total RNA sample is between 1.6 and 2. 0,this demonstrate the purity of the sample is enough.3. The RT - PCR product is 366bp,the extent is conformity with our expectation.4. The expression of GLAST mRNA was significant higher in SER than in Wistar.5. The GLAST protein was lower in dentate gyrus (DG) and CA3 of hippocampus in SER than in Wistar .Conclusion1. Down - regulation of GLAST protein was correlated with the occurrence of epilepsy inSER.2. The increase of glutamate release and uptake in epilepsy make the GLAST mRNA up regulation.3 . Glial cells may affect the occurrence of epilepsy through the role of glutamate transporters.
Keywords/Search Tags:Glutamate transporters, GLAST, SER, epilepsy, hippocampus
PDF Full Text Request
Related items